Open Access

Development of duplex PCR for differential detection of goatpox and sheeppox viruses

BMC Veterinary ResearchBMC series – open, inclusive and trusted201713:278

https://doi.org/10.1186/s12917-017-1179-0

Received: 16 January 2017

Accepted: 10 August 2017

Published: 31 August 2017

Abstract

Background

Clinically, sheeppox and goatpox have the same symptoms and cannot be distinguished serologically. A cheaper and easy method for differential diagnosis is important in control of this disease in endemic region.

Methods

A duplex PCR assay was developed for the specific differential detection of Goatpox virus (GTPV) and Sheeppox virus (SPPV), using two sets of primers based on viral E10R gene and RPO132 gene.

Results

Nucleic acid electrophoresis results showed that SPPV-positive samples appear two bands, and GTPV-positive samples only one stripe. There were no cross-reactions with nucleic acids extracted from other pathogens including foot-and-mouth disease virus, Orf virus. The duplex PCR assay developed can specially detect SPPV or GTPV present in samples (n = 135) collected from suspected cases of Capripox.

Conclusions

The duplex PCR assay developed is a specific and sensitive method for the differential diagnosis of GTPV and SPPV infection, with the potential to be standardized as a detection method for Capripox in endemic areas.

Keywords

Goatpox virus Sheeppox virus Duplex PCR assay Differential diagnosis

Background

Goatpox virus (GTPV) and sheeppox virus (SPPV) are members of the genus Capripoxvirus (CaPV) of the family Poxviridae, which also contains the lumpy skin disease virus (LSDV). GTPV and SPPV can cause systemic poxviral diseases of domesticated small ruminants [13], which are classified as notifiable diseases by World Organization for Animal Health (OIE). Morbidity and mortality varied with different animal species [4]. Mild infections are usual among native breeds in endemic areas and the morbidity ranges from 1% to 75% or higher [5]. In contrast, more severe clinical symptoms are observed in animals with concurrent infections, stressed or young animals, or animals from regions where the poxviral diseases have not happened for long time. The mortality was close to 100% in these highly susceptible animals [6]. The genome of CaPV is about 150 kbp of double-stranded DNA, which shares more than 147 putative genes, including conserved poxvirus structural and replicative genes, and genes likely involved in host range and virulence [7]. Sheeppox and goatpox is an economically important disease in goat and sheep-producing areas of the world [8]. Sheeppox and goatpox have the same symptoms and are clinically distinguishable. For accurately and promptly controlling any outbreak of sheeppox and goatpox, the foremost requirement is a specific tool for differential detection of the causative agents. Digestion of CaPV p32 gene with Hinf I and sequence alignment of GpCR gene were developed to discriminate GTPV and SPPV [9, 10]. In this study, a duplex polymerase chain reaction (PCR) assay based on the E10R and RPO132 gene was developed to distinguish GTPV and SPPV. The performance of the assay was evaluated with clinical samples. In comparison with the PCR-RFLP, the newly established duplex PCR assay is a time-efficient and simple alternative for differential diagnosis of GTP and SPP that could be used as a diagnostic tool in clinical samples.

Methods

Gene sequences and primers design

PCR primers were designed using Primer Premier 5.0 software based on E10R gene and RPO132 gene of GTPV and SPPV E10R gene. Selection of these targets for primer designs were based upon previous bioinformatics analyses of CaPV genomes and corresponding homologs from other near-neighbor viruses listed in the NCBI (National Center for Biotechnology Information) database (data not shown). Nucleotide sequences of the primers are shown in Table 1 and Fig. 1. A nonspecific sequence highlighted in bold was added at 5′ end of each primer (E10R-f primer: “CCGCTCGAGGCCACC”; E10R-r primer: “CGCGGATCCCGC” RPO132-f: “CGCGGATCCCGC” and RPO132-r: “CCGCTCGAGGC CACC”).
Table 1

Primer designed to detect goatpox and sheeppox virus by duplex PCR

Primer name

Length

Sequence(5′-3′)

Notes

E10R-f

41

CCGCTCGAGGCCACCATGAATCCTAAACACTGGGGAAGAGC

The universal primers for GTPV and SPPV RPO40 gene, the predicted length of PCR is 285 bp.

E10R-r

36

CGCGGATCCCGAAGCGGTAATACCTTATTTAAATTG

RPO132-f

39

CCGCTCGAGGCCACCATGAATAGGTTCAAGGAAAAGCAT

The special PCR primers for SPPV RPO132 gene, the predicted length of Lamp is 746 bp.

RPO132-r

30

CGCGGATCCCGCATTATTTTTTCATACGAT

Fig. 1

Target gene sequences and primers. Nucleotide sequences of the E10R and RPO132 amplicon (E10R, RPO132 GenBank accession no. AY077832.1) and locations of the primers along the sequence

Viruses

SPPV Gulang/2009 strain was isolated and adapted in Vero cell culture. GTPV AV40 vaccine strains adapted in Vero cell culture was obtained from the Institute of Veterinary Drug Control, Beijing, China. The nucleic acid extracted from foot-and-mouth disease virus (FMDV) isolates was provided by the National Foot-and-Mouth Disease Reference Laboratory, LVRI, and the nucleic acids extracted from Mycoplasma ovipneumoniae (M. ovipneumoniae), Chlamydia psittaci, L. interrogans, Toxoplasma gondii and Babesia were provided by the Key Laboratory of Veterinary Parasitology of Gansu Province, LVRI. The clinical samples collected from suspected cases of goatpox and sheeppox were stored in PBS, pH 7.4 and a 10% (w/v) suspension was made for extraction of total gDNA using commercial DNA extraction kit (TaKaRa, Dalian, China) according to the manufacture’s instruction.

Reaction mixtures and optimal duplex PCR conditions

Duplex PCR reactions were carried out in a volume of 25 μL containing 10 μL premix Taq (TaKaRa, Dalian, China), 0.2 μM of each of the E10R-f and E10R-r primers, 1.0 μM of each of the RPO132-f and RPO132-r primers and 2 μL (100 ng) of extracted SPPV or GTPV gDNA as template. The duplex PCR assay was performed at the following conditions: initial denaturizing at 94 °C for 4 min, followed by 34 cycles of 94 °C for 30 s, 50 °C for 30 s, 72 °C for 45 s and final extension of 72 °C for 5 min.

Analysis of duplex PCR products

Products were separated electrophoretically in 1% agarose gel (Gelrose TM, Life Technologies, USA) containing 0.5 g/ml ethidium bromide, followed by visualization under ultraviolet (UV) light. 6 μL of duplex PCR products was used for visualization and the electrophoresis was done for 20 min at a constant 120 V. After visualization, the picture was documented using a gel documentation system (Peiqing Image Biosystem, Shanghai).

Duplex PCR sensitivity

The sensitivity of the duplex PCR assay was tested using 10-fold serially diluted GTPV (1.011 × 1010–1.011 × 100 copies per μL) or SPPV DNA (1.043 × 1010–1.043 × 100 copies per μL) as template.

Duplex PCR specificity

The specificity of the duplex PCR assay was evaluated by using purified the nucleic acids extracted from sheep, goats and some wild ruminants, SPPV, GTPV, Orf, FMDV, M.ovippneumoniae, Chlamydia psittaci, L.interrogans, Toxoplasma gondii, Babesia and a control without template was also included as a negative control in each test. The duplex PCR products were sequenced to further confirm the specificity of the assay.

Evaluation of the duplex PCR assay in clinical samples

The performance of the duplex PCR assay was evaluated with 135 clinical samples preserved in our laboratory. These samples were pre-screened by PCR-RFLP [9, 10] and LAMP [11] as previously reported. Among them 48 samples were collected from goats infected with GTPV and 87 from sheep infected with SPPV. Animal experimentations were performed inside the biosafety facilities of the Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences (LVRI, CAAS), in compliance with the regulations of the Animal Ethics Procedures and Guidelines of the People’s Republic of China (AEPGPRC).

Results

Primers and gene sequences

Several GTPV and SPPV genomic sequences were downloaded from GenBank and aligned with each other using the MegAlign. The most conserved segments within the E10R and RPO132 genes of GTPV and SPPV were selected as the targets. All primers were designed by the software Primer Premier 5.0. Two pairs of primers were used for the duplex PCR assay, i.e., E10R primers (E10R-f and E10R-r) and RPO132 primers (RPO132-f and RPO132-r). The sequences of all primers were shown in Table 1.

Optimization of duplex PCR reaction conditions

The SPPV specific primers (RPO132) amplified approx. 746 bp fragments and the GTPV specific primers (E10R) amplified approx. 285 bp fragments as expected, when visualized in 1% agarose gel using ethidium bromide staining (Fig. 2).
Fig. 2

Optimization of annealing temperature (Tm) for duplex PCR reaction in the detection of GTPV or SPPV using mix primers. Agarose gel electrophoresis showing the effect of Tm on duplex PCR. a Duplex PCR amplicated products using 100 ng SPPV gDNA as template. b Duplex PCR amplicated products using 100 ng GTPV gDNA as template. Lane 1–6 is 46 °C, 48 °C, 50 °C, 52 °C, 54 °C and 56 °C, respectively; Lane M: 2000 bp DNA Ladder Marker (TaKaRa, Dalian) and Lane C: No template control

To determine the optimal temperature for amplification in the duplex PCR assay, a range of temperatures from 46 °C to 56 °C were tested. The results showed that the targeted GTPV and SPPV genes can be amplified at all of above annealing temperature using E10R and RPO132 mix primers, respectively. As shown in Fig. 2 the strongest amplified products were observed at 50 °C. In the optimization of ratio of E10R to RPO132 primers, it was found that

the targeted genes can be amplified at any proportion of E10R and RPO132 primers, respectively. However, the best amplification occurred when each of RPO132 primers is 1 μM and each of E10R primers is 0.2 μM, respectively (Fig. 3).
Fig. 3

Optimization of primers rate for duplex PCR reaction. Lane 1–5 and 1′-5′: E10R primers is 0.5 μM, RPO132 primers is 0.2 μM, 0.4 μM, 0.6 μM, 0.8 μM and 1 μM, respectively; Lane 6–10 and 6′-10′: RPO132 primers is 0.5 μM, E10R primers is 0.2 μM, 0.4 μM, 0.6 μM, 0.8 μM and 1 μM, respectively. Lane1–5 and 6–10: 100 ng SPPV genome as templates; Lane1’-5’and 6′-10′: 100 ng GTPV genome as templates, respectively. Lane C and C′: No template control. Lane M:2000 bp DNA Ladder Marker (TaKaRa, Dalian). The strip in red grid showed the result is better using 1 μM RPO132 primers and 0.2 μM E10R primers in the reaction

In determination of the best reaction cycles, the results showed that the targeted genes can be produced after 25 cycles to 40 cycles using the optimized concentration of the primers at 50 °C, and the amplified products at 35 cycles was clearer (Fig. 4) than other cycle conditions.
Fig. 4

Optimization of reaction cycles for duplex PCR reaction in the detection of GTPV or SPPV using mix primers. Agarose gel electrophoresis showing the effect of cycles on duplex PCR. a Duplex PCR amplicated products using 100 ng SPPV gDNA as template. b Duplex PCR amplicated products using 100 ng GTPV gDNA as template. Lane 1–5: Reaction annealing temperature is 50 °C for 20 cycles, 25 cycles, 30 cycles, 35 cycles and 40 cycles; Lane C: No template control and Lane M: 2000 bp DNA Ladder Marker (TaKaRa, Dalian)

Duplex PCR sensitivity for detection of GTPV and SPPV

To determine the sensitivity of the duplex PCR assay developed, a serial dilutions of the purified genome DNA (gDNA) of SPPV and GTPV were used. The concentration of the purified viral gDNA was measured by NanoDrop 2000 (Thermo Scientific). SPPV Gulang/2009 gDNA was ten-fold diluted ranging from 1.011 × 1010–1.011 × 100 copies and GTPV AV40 gDNA was diluted ranging from 1.043 × 1010–1.043 × 100 copies respectively. After amplification under the optimized conditions as described above 6 μL PCR amplified products e was tested by nucleic acid electrophoresis, and then was observed by UV gel imaging system. The results showed that the duplex PCR assay was able to specifically amplify the SPPV gDNA from 1.011 × 1010–1.011 × 104 copies, and the control group had no stripe (Fig. 5a). 1.043 × 105 copies of GTPV gDNA template was detected (Fig. 5b, Table 2).
Fig. 5

Duplex PCR sensitivity. Amplification using different concentration gradient of the gene as template, nucleic acid electrophoresis test results. a Lane 1–10: SPPV gDNA concentration gradient for 1.011 × 1010–1.011 × 100 copies as template, (b) Lane 1–10: GTPV gDNA concentration gradient for 1.043 × 1010–1.043 × 100 copies as template, respectively. Lane M: 2000 bp DNA Ladder Marker (TaKaRa, Dalian) and Lane C: No template control

Table 2

Comparison of LAMP method [19] sensitivity with the duplex PCR

Methods

Templates

Sensitivity (copies/reaction)

  

109

108

107

106

105

104

103

102

101

100

Duplex PCR

GTPV

+

+

+

+

+

Duplex PCR

SPPV

+

+

+

+

+

+

GTPV LAMP

GTPV

+

+

+

+

SPPV LAMP

SPPV

+

+

+

+

+

+

GSPV LAMP

GTPV/SPPV

+

+

+

+

+

+

+

Note: Detection of about 100 ng GTPV AV40 or SPPV Gulang/2009 genome DNA using different methods. “+” stand for positive result and “-” stand for negative result

Duplex PCR assay specificity

In investigation of the specificity of the duplex PCR assay, the reactions were performed using a panel of genomes extracted from GTPV, SPPV, Orf virus, FMDV, M. ovippneumoniae, Chlamydia psittaci, L.interrogans, Toxoplasma gondii were tested, respectively. The duplex PCR assay was shown to be specific for the detection of GTPV and SPPV, respectively and there was no cross-reaction with genome of Orf, FMDV, M. ovippneumoniae, Chlamydia psittaci, L.interrogans, Toxoplasma gondii, Babesia, and without template control (Fig. 6). The duplex PCR products were then sequenced and found to match with the corresponding nucleotide sequences of E10R or RPO132 gene (data not shown). Phylogenetic tree analysis showed that the SPPV Gulang/2009 and other isolated SPPVs were distinctly different from GTPVs and LSDVs.
Fig. 6

Specificity of duplex PCR for detection different pathogen nucleic acid. Aboat 100 ng DNA or cDNA template of ten different sheep or goat pathogens were used in LAMP reaction. Agarose gel electrophoresis (1%) of PCR products stained with Ethidium bromide and visualized under UV transilluminator. Lane 1: SPPV; Lane 2: GTPV; Lane 3: Orf virus; Lane 4: FMDV O/China 99; Lane 5: M. ovippneumoniae; Lane 6: Chlamydia psittaci; Lane 7: L.interrogans; Lane 8: Toxoplasma gondii; Lane 9: Babesia; C: No template control and Lane M: 2000 bp DNA Ladder Marker (TaKaRa, Dalian)

Performance of the duplex PCR assay on clinical samples

All the clinical samples (n = 135) were detected by the duplex PCR assay, and the results were then compared to the PCR-RFLP assay [9, 10] and LAMP method [11]. The results showed that 48 samples were determined to be positive for GTPV and 87 samples were positive for SPPV by the duplex PCR assay, respectively, which was 100% consistent with the LAMP method and PCR-RFLP assay (Table 3).
Table 3

Results of different methods detection with clinic samples

Methods

Sample size

Positive result

Negative result

Positive detection rates (%)

Sample category

PCR-RFLP [9, 10]

135

135

0

100

48 GTPV samples and 87 SPPV samples

GSPV lamp [19]

135

135

0

100

GTPV lamp [19]

135

48

87

100

SPPV lamp [19]

135

86

49

98.8

Duplex PCR

135

135

0

100

Discussion

GTPV and SPPV genomes are approximately 150kbp double-stranded DNA, which share at least 147 putative genes, including conserved poxvirus replication and structural genes and genes likely involved in virulence and host range [7]. Restriction endonuclease analysis and cross-hybridization studies of SPPV and GTPV indicate that these viruses, although closely related (estimated 96 to 97% nucleotide identity), can be distinguished from one another and may undergo recombination in nature. Several PCR tests have been developed for the detection of CaPV [1219], but only PCR-RFLP assay was developed to distinguish them in the beginning. However, PCR-RFLP assay is time consuming, and expensive and requires a high degree of laboratory experience in molecular biology. Then a LAMP method was developed for the specific differential detection of GTPV and SPPV, using three sets of LAMP primers designed on the basis of the ITRs [11]. LAMP for distinguishing GTPV and SPPV was performed at 62 °C in 45–60 min. However, the operation of the experiment requires extreme caution because of its high sensitivity leading to contamination. There is a real need for a more convenient alternative to PCR that is inexpensive, and easy to operate and maintain.

E10R is encoded by ORF40 gene and RNA polymerase subunit RPO132 is encoded by ORF116 gene. The E10R sequence of GTPV and SPPV showed high homologies to VACV E10R sequence, and RPO132 sequences of GTPV and SPPV showed high homologies to VACV A32R sequence. Initially, we found E10R primer designed based on SPPV E10R gene can amplify target gene from SPPV genome, also can amplify target gene from GTPV genome. RPO132 primer designed based on SPPV RPO132 gene only can amplify target gene from SPPV genome, but cannot amplify target gene from GTPV genome. But both annealing temperature of E10R and RPO132 primers will not be able to adjust to a consistent system. We initially planned to express E10R and RPO132, and inserted them into expression vector by enzyme restriction sites we added in the primers. So, non-specific sequences including Kozak sequence, restriction enzyme sites and protective bases or only restriction enzyme sites and protective bases sequences were added located in front of the initiation codon in upstream primer or added located behind termination codon in downstream primer, respectively. Accidentally, we found the above primers added non-specificity sequence can amplify the specificity target and the annealing temperature can be consistent at the same time in one system. E10R and RPO132 primers adding the nonspecific sequence can differential detect SPPV and GTPV obviously (Fig. 7). That is to say, added nonspecific sequence E10R and RPO132 primers mixture can specific amplification two target genes sizes obvious differences from SPPV genome, respectively, and can only amplify one gene from GTPV genome in this study (Fig. 7). Related experiments showed that the sequences of the duplex PCR primers can specificity amplify two target genes from SPPV nucleic acid, but only one target gene can be amplified from GTPV nucleic acid under the same conditions. Further experiments proved that this duplex PCR analysis can fully distinguish between GTPV and SPPV.
Fig. 7

Single PCR and duplex PCR for detection different GTPV and SPPV nucleic acid using E10R primers and RPO132 primers or mix primers. Lane 1–3: single PCR detect 100 ng SPPV gDNA, 100 ng GTPV gDNA and no template using RPO132 primers; Lane 4–6: single PCR detect 100 ng SPPV gDNA, 100 ng GTPV gDNA and no template using E10R primers; Lane 7–9: duplex PCR detect 100 ng SPPV gDNA, 100 ng GTPV gDNA and no template using mixture of RPO132 primers and E10R primers. Lane M: 2000 bp DNA Ladder Marker (TaKaRa, Dalian)

One hundred thirty-five epidemic materials preserved in our laboratory were tested using duplex PCR diagnosis method, the results were consistent with the laboratory tested results (Table 3), which suggests the duplex PCR is able to detect the clinal samples.

Conclusion

The present study showed that the duplex PCR method of differential detection of GTPV and SPPV is highly specific, and sensitive. Thus, it might be the optimal detection system for field detection and differential diagnosis of GTP and SPP. It is a promising assay for extensive application for the diagnosis of GTPV and SPPV infection in the laboratory and field, especially in countries that lack the resources needed for molecular diagnostic techniques.

Abbreviations

CaPV: 

Capripoxvirus

gDNA: 

Genome DNA

GTPV: 

Goatpox virus

LSDV: 

lumpy skin disease virus

ORF: 

Open reading frame

PCR-RFLP; RFLP-PCR: 

Polymerase chain reaction-restriction fragment length polymorphism

SPPV: 

Sheeppox virus

UV: 

Ultraviolet light

Declarations

Acknowledgments

The work was supported by the Key Project of Chinese National Programs for Fundamental Research and Development (2016YFD0500907 and 2017YFD0502306 for Zhang Q) and the National Natural Science Foundation of China (31201892 to Zhao Z and 31502096 to Zhu X), and Central Public-interest Scientific Institution Basal Research Fund (1610312016015 to Zhao Z) and Program for International S&T Cooperation Projects of Gansu Province (1604WKCA012 for Zhang Q), and the Public-Sector Research Special Foundation of AQSIQ (no.201310093).

Availability of data and materials

The datasets during and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors’ contributions

ZXZ assisted in experimental design of the study, and wrote this manuscript and prepared figures for publication. Most of the experiments were conducted by ZXZ who developed and optimized duplex PCR assays; GW helped to construct partial plasmids and analyzed data; XY finished the RFLP-PCR experiments. XZ and QZ provided reference viruses and field isolates of GTPV and SPPV. QZ and ZZ analyzed data and modified the manuscript. The final manuscript was read and approved by all the authors.

Ethics approval

This study was approved by the Animal Ethics Committee of Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences (approval number LVRIAEC 2012–018). Goats and sheep, from which tissues samples were collected, were handled with good animal practices required by the Animal Ethics Procedures and Guidelines of the People’s Republic of China (AEPGPRC). The collection of tissues samples was performed as part of routine process of disease monitoring and surveillance for these goats and sheep. The owners of goats and sheep had given permission for the collection of tissues samples.

Consent for publication

Not applicable

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Key Laboratory of Animal virology of the Ministry of Agriculture, State Key Laboratory of Veterinary Etiological Biology, Lanzhou Veterinary Research Institute, CAAS

References

  1. Coetzer JAW, Guthrie AJ. African horse sickness. In: Coetzer JAW, Tustin RC, editors. Infectious Diseases of Livestock, vol. 3 vols. Cape Town: Oxford University Press; 2004. p. 1231–46.Google Scholar
  2. Esposito JJ, Fenner F. Poxviruses in fields. In: Howley PM, Knipe DM, editors. Fields Virology. Philadelphia, PA, USA: Lippincott Williams & Wilkins Publishers; 2001. p. 2885–921.Google Scholar
  3. Fields BN, Knipe DM, Howley PM, Chanock RM, Melnick JL, Monathy TP, Roizman B, Straus SE (ed.). Fields virology, 4th ed. Lippincott, Williams and Wilkins, Philadelphia, Pa., 45 Munz, E.& K. Dumbell. Sheeppox and goatpox. 1994; p.613–615.Google Scholar
  4. Yeruham I, Yadin H, Van Ham M. Economic and epidemiological aspects of an outbreak of sheeppox in a dairy sheep flock. Vet Rec. 2007;160:236–7.View ArticlePubMedGoogle Scholar
  5. Babiuk S, Bowden TR, Boyle DB, Wallace DB, Kitching RP. Capripoxviruses: an emerging worldwide threat to sheep, goats and cattle. Transbound Emerg Dis. 2008;55:263–72.View ArticlePubMedGoogle Scholar
  6. Sadri R. Prevalence and economic significance of goat pox virus disease in semi-arid provinces of Iran. Iran J Vet Med. 2012;6:187–90.Google Scholar
  7. Tulman ER, Afonso CL, Lu Z, Zsak L, Sur JH, Sandybaev NT, Kerembekova UZ, Zaitsev VL, Kutish GF, Rock DL. The genomes of sheeppox and goatpox viruses. J Virol. 2002;76:6054–61.View ArticlePubMedPubMed CentralGoogle Scholar
  8. Senthilkumar V, Thirunavukkarasu M. Economic losses due to sheep pox in sheep farms in Tamil Nadu. Tamil Nadu Journal of Veterinary and Animal Sciences. 2010;6:88–94.Google Scholar
  9. Yan XM, Zhang Q, Wu GH, Li J, Zhu HX. Discrimination of Goatpox virus and Sheeppox virus by digestion of p32 gene with Hif I andsequence alinment of GpCR gene. Animal husbandry and feed Sci. 2010;2:32–34,38.Google Scholar
  10. Yan XM, Chu YF, Wu GH, Zhao ZX, Li J, Zhu HX, Zhang Q. An outbreak of sheep pox associated with goat poxvirus in Gansu province of China. Vet Microbio. 2011;156:425–8.View ArticleGoogle Scholar
  11. Zhao Z, Fan B, Wu G, Yan Y, Li Y, Zhou X, Yue H, Dai D, Zhu H, Tian B, Li J, Zhang Z. Development of loop-mediated isothermal amplification assay for specific and rapid detection of differential goat Pox virus and Sheep Pox virus. BMC Microbiol. 2014;14:10.View ArticlePubMedPubMed CentralGoogle Scholar
  12. Gershon PD, Black DN. The nucleotide sequence around the Capripoxvirus thymidine kinase gene reveals a gene shared specifically with leporipoxvirus. J Gen Virol. 1989;70:525–33.View ArticlePubMedGoogle Scholar
  13. Gershon PD, Kitching RP, Hammond JM, Black DN. Poxvirus genetic recombination during natural virus transmission. J Gen Virol. 1989;70:485–9.View ArticlePubMedGoogle Scholar
  14. Kitching RP, Bhat PP, Black DN. The characterization of African strains of Capripoxvirus. Epidemiol Infect. 1989;102:335–43.View ArticlePubMedPubMed CentralGoogle Scholar
  15. Mirzaiel K, Barani MS, Bokaie S. A review of sheep pox and goat pox: perspective of their control and eradication in Iran. J Adv Vet Anim Res. 2015;2(4):373–81.Google Scholar
  16. Rao TVS, Bandyopadhyay SK. A comprehensive review of goat pox and sheep pox and their diagnos. Anim Health Res Rev. 2000;1:127–36.View ArticlePubMedGoogle Scholar
  17. Zheng M, Liu Q, Jin N. A duplex PCR assay for simultaneous detection and differentiation of Capripoxvirus and Orf virus. Mol Cell Probes. 2007;21:276–81.View ArticlePubMedGoogle Scholar
  18. Tian H, Wu J, Zhang K. Development of a SYBR green real-time PCR method for rapid detection of sheep pox virus. Virol J. 2012;9:1–4.View ArticleGoogle Scholar
  19. Venkatesan G, Balamurugan V, Bhanuprakash V. Multiplex PCR for simultaneous detection and differentiation of sheeppox, goatpox and orf viruses from clinical samples of sheep and goats. J Virol Methods. 2014;195:1–8.View ArticlePubMedGoogle Scholar

Copyright

© The Author(s). 2017

Advertisement