Skip to main content

Advertisement

Table 1 Primer designed to detect goatpox and sheeppox virus by duplex PCR

From: Development of duplex PCR for differential detection of goatpox and sheeppox viruses

Primer name Length Sequence(5′-3′) Notes
E10R-f 41 CCGCTCGAGGCCACCATGAATCCTAAACACTGGGGAAGAGC The universal primers for GTPV and SPPV RPO40 gene, the predicted length of PCR is 285 bp.
E10R-r 36 CGCGGATCCCGAAGCGGTAATACCTTATTTAAATTG
RPO132-f 39 CCGCTCGAGGCCACCATGAATAGGTTCAAGGAAAAGCAT The special PCR primers for SPPV RPO132 gene, the predicted length of Lamp is 746 bp.
RPO132-r 30 CGCGGATCCCGCATTATTTTTTCATACGAT