Skip to content


  • Research article
  • Open Access

Attenuated Actinobacillus pleuropneumoniae double-deletion mutant S-8∆clpP/apxIIC confers protection against homologous or heterologous strain challenge

  • Fang Xie1,
  • Gang Li1,
  • Long Zhou1,
  • Yanhe Zhang1,
  • Ning Cui1,
  • Siguo Liu1 and
  • Chunlai Wang1Email author
Contributed equally
BMC Veterinary ResearchBMC series – open, inclusive and trusted201713:14

Received: 16 August 2016

Accepted: 15 December 2016

Published: 6 January 2017



Actinobacillus pleuropneumoniae is the etiological agent of porcine pleuropneumonia, which leads to large economic losses to the swine industry worldwide. In this study, S-8clpPapxIIC, a double-deletion mutant of A. pleuropneumoniae was constructed, and its safety and protective efficacy were evaluated in pigs.


The S-8clpPapxIIC mutant exhibited attenuated virulence in a murine (BALB/c) model, and caused no detrimental effects on pigs even at a dose of up to 1.0 × 109 CFU. Furthermore, the S-8clpPapxIIC mutant was able to induce a strong immune response in pigs, which included high levels of IgG1 and IgG2, stimulated gamma interferon (IFN-γ), interleukin 12 (IL-12), and interleukin 4 (IL-4) production, and conferred effective protection against the lethal challenge with A. pleuropneumoniae serovars 7 or 5a. The pigs in the S-8clpPapxIIC immunized groups have no lesions and reduced bacterial loads in the lung tissue after challenge.


The data obtained in this study suggest that the S-8clpPapxIIC mutant can serve as a highly immunogenic and potential live attenuated vaccine candidate against A. pleuropneumoniae infection.


Actinobacillus pleuropneumoniae Live attenuated vaccinePorcine pleuropneumonia


Actinobacillus pleuropneumoniae is a highly adapted pathogen that causes porcine pleuropneumonia, which is an extremely contagious respiratory disease [1]. The disease is often fatal and characterized by fibrinous, hemorrhagic, and necrotic lung lesions, which remains an important global problem in the swine industry [2]. Transmission of the pathogen occurs through an aerosol route during close contact with diseased pigs or asymptomatic carriers, and it can infect pigs of different ages [3]. The clinical features can span from peracute disease with quick death to chronic infection leading to reduced growth rates, and the pigs frequently become asymptomatic carriers. To date, 16 serovars of A. pleuropneumoniae have been identified and all serovars can cause disease [4, 5]. Although the incidence of outbreaks has reduced in the developed countries, A. pleuropneumoniae remains one of the main causes of economic loss to the global swine production, especially in developing countries [6].

Antimicrobial therapy has been used to prevent and control porcine pleuropneumonia, but it results in the growing problems of multidrug-resistance and antibiotic residues in pigs [79]. Concern was raised that multidrug-resistance could be transmitted between different pathogens in pigs followed through the food chain to produce a risk to human health. Thus, vaccination becomes the most effective method of preventing A. pleuropneumoniae infection. It has been found that pigs surviving natural infection were protected against homologous and heterologous serovar infection [10]. It is speculated that live bacteria can induce in vivo expression of protective antigens and confer cross-protection. Thus, the application of an attenuated live vaccine is an ideal approach for vaccination against diversified serovars of A. pleuropneumoniae [11, 12].

ClpP protease is a family of ATP-dependent protease, which plays a key role in the degradation of misfolded proteins and the stress tolerance in bacteria [13]. The role of ClpP as an important virulence factor has been demonstrated in several pathogenic bacteria [14, 15]. A previous study of Salmonella typhimurium and Salmonella enteritidis also showed that the virulence of clpP deletion mutants were remarkably decreased and that these mutants can serve as live oral vaccine candidates [16]. In our previously study, the clpP-deleted mutant of A. pleuropneumoniae serovar 7, a prevalent serovar in China, was constructed and its physiological features were analyzed. The ClpP protease mediates A. pleuropneumoniae tolerance to multiple environmental stressors, affects the biofilm formation, and may play a critical role in the virulence regulation [17]. The ApxII toxin is the most important virulence factor in A. pleuropneumoniae serovar 7, and is encoded by the apxIICA gene cluster. The apxIIA gene encodes the ApxIIA toxin structural protein, and the apxIIC gene encodes the post-translational activating protein that is essential for the ApxII toxin activation, thus disruption in the apxIIC gene of A. pleuropneumoniae results in secretion of the inactive ApxII toxin but with full antigenicity [18].

In the present study, we constructed the double-deletion mutant S-8clpPapxIIC of A. pleuropneumoniae and evaluated the feasibility of its use as a live attenuated negative marker vaccine based on the virulence, changes in clinical symptoms, immune responses, and protective effects in pigs against challenge with the homologous and heterologous A. pleuropneumoniae strains.


Experimental animals

One hundred and ten 6-week-old female BALB/c mice (Beijing Vital River Laboratory Animal Co., Ltd.) were used in the study, with identical feeding conditions. A total of 45 piglets were obtained for use in this study from a farm that was free from A. pleuropneumoniae and other respiratory pathogens including Streptococcus suis, Haemophilus parasuis, and porcine reproductive and respiratory syndrome virus (PCR-negative for nasal and tonsillar swabs and serological-negative in corresponding ELISA assays). The 45 piglets were randomly divided into nine groups of same number and were separately fed with same feeding conditions. The animal experiment in this study was approved by the Animal Ethics Committee of Harbin Veterinary Research Institute of the Chinese Academy of Agricultural Sciences (CAAS) and carried out in strict accordance with animal ethics guidelines and approved protocols.

Bacterial strains and growth conditions

A. pleuropneumoniae strains S-8 (serovar 7), Shope 4074 (serovar 1), K17 (serovar 5a), the S-8clpP mutant and the S-8clpPapxIIC mutant were grown at 37 °C in tryptic soy broth (TSB) or tryptic soy agar (TSA) (Becton Dickinson, Franklin Lakes, NJ, USA) containing nicotinamide dinucleotide (NAD, 10 μg/mL; Sigma-Aldrich).

Chromosomal inactivation of the apxIIC gene of S-8clpP

Primers IICLF/IICLR, and IICRF/IICRR (Table 1) were used to amplify the two segments flanking with the apxIIC gene, IIC-L and IIC-R, as the recombination homologous arms. Using single-overlap extension PCR (SOE PCR), the fragment with a 270 bp internal deletion in the apxIIC gene (from nt 18 to 297) was generated, and cloned into the conjugative vector pEMOC2 [19] to construct plasmid pEMapxIIC. Using E. coli β2155 and a single-step transconjugation system [20, 21], plasmid pEMapxIIC was applied to introduce the apxIIC mutation into the S-8clpP mutant. After two homologous recombination steps, the A. pleuropneumoniae S-8clpPapxIIC mutant strain was verified by PCR and sequencing using IICJDF/IICJDR primers.
Table 1

Characteristics of bacterial strains, plasmids, and primers used in this study

Strains, plasmids, and primers

Characteristics or sequence

Source or reference


E. coli β2155

thrB1004 pro thi strA hsdS lacZM15 (F’ lacZM15 lacl q traD36 proA + proB +)dap :: erm (Ermr))recA :: RPA-2-tet(Tcr)::Mu-km (Kmr) λpir


A.pleuropneumoniae S-8

A. pleuropneumoniae serotype 7 clinical isolate from the lung of a diseased pig in northern China


A.pleuropneumoniae S-8clpP

Unmarked clpP gene knockout mutant of A. pleuropneumoniae S-8


A.pleuropneumoniae S-8clpPapxIIC

Unmarked clpP/apxIIC genes knockout mutant of A. pleuropneumoniae S-8

This work



Conjugative vector based on pBluescript SK with mob RP4, polycloning site, Cm r , and transcriptional fusion of the omlA promoter with the sacB gene

Accession no. AJ868288



Conjugative vector pEMOC2 with a 270 bp deletion in the apxIIC gene which have a 1.4-kb upstream fragment and 1.4-kb downstream fragment

This work



5’ GCGTCGACATGACAACACCAATGATTGATTTAC 3’, upstream primer with internal SalI site (underlined)

This work


5’ AATCCCCGAA AGCATCATCCCTCCCATTC 3’, downstream primer with reverse complement sequence(underlined) of sequence in bold from primer IICRF

This work


5’ GGATGATGCT TTCGGGGATTCATCTCTATTG 3’, upstream primer with reverse complement sequence(underlined) of sequence in bold from primer IICLR

This work


5’ TTGCGGCCGCGTTGTAATAAGTCCCGTAACACCAG 3’, downstream primer with internal NotI site (underlined)

This work


5’ GAAGAGCCATTACCCAACAAC 3’, upstream primer for identification of apxIIC gene deletion

This work


5’ ATACAATAGAGATGAATCCCCG 3’, downstream primer for identification of apxIIC gene deletion

This work

Growth experiment and hemolytic assay

A. pleuropneumoniae wild-type strain S-8, the S-8clpP mutant, and the S-8clpPapxIIC mutant were routinely grown in 3 ml of TSB for 16 h, then diluted to OD600 of 0.1. The fresh cultures were then inoculated in 30 ml of TSB and grown at 37 °C. The OD600 values were recorded at an interval of 1 h using the Eppendorf BioPhotometer (Eppendorf, Germany).

A. pleuropneumoniae wild-type strain S-8, the S-8clpP mutant, and the S-8clpPapxIIC mutant were respectively inoculated onto TSA plates supplemented with 5% defibrinated sheep erythrocytes, and incubated at 37 °C for 18 h. The hemolysis activity was assessed by visualizing clear zones around the colony.

Virulence studies in mice

To determine the residual virulence of the S-8clpPapxIIC mutant, various concentrations of A. pleuropneumoniae strains S-8 and S-8clpPapxIIC mutant were injected intraperitoneally into mice. One hundred and ten 6-week-old female BALB/c mice (Beijing Vital River Laboratory Animal Co., Ltd.) were randomly divided into eleven experimental groups (n = 10). Five experimental groups were inoculated with 100 μL of PBS containing the S-8clpPapxIIC mutant (1.0 × 108 to 1.0 × 1010 CFU/mouse, Table 2). As a positive control, five experimental groups were inoculated with the wild-type strain S-8 (1.0 × 105 to 1.0 × 107 CFU/mouse, Table 2) using the identical method. Non-infected mice in the control group were inoculated with 100 μL of sterile PBS. After infection, mice were monitored twice daily for a 14-day period and humanely euthanized if moribund [22]. The 50% lethal dose (LD50) values of S-8 and S-8clpPapxIIC were calculated by Karber’s method [23].
Table 2

Virulence of S-8clpPapxIIC and the wild-type strain S-8 of A. pleuropneumoniae in mice


Challenge dose a (CFU)

No. dead/No.tested

Value of LD50 b (CFU)

Fold attenuation c


1.0 × 107


5.62 × 105


3.16 × 106


1.0 × 106


3.16 × 105


1.0 × 105



1.0 × 1010


1.12 × 109


3.16 × 109


1.0 × 109


3.16 × 108


1.0 × 108



PBS broth




a Groups of ten BALB/c mice were given intraperitoneal injections of 100 μL of bacterial suspension containing various quantities of A. pleuropneumoniae strains. Survival was recorded for 14 days after infection

b LD50 was calculated by the Karber’s method [23]

c Fold attenuation was normalized to wild-type strain S-8

Virulence studies in pigs

Twenty-five 8-week-old pigs were randomly assigned into five experimental groups (n = 5). The pigs in group 1 were inoculated with 1 × 107 CFU of S-8clpPapxIIC via an intranasal (i.n.) route. The pigs in group 2 were injected with 1 × 107 CFU of S-8 via the i.n. route. The pigs in group 3 were injected with 1 × 109 CFU of S-8clpPapxIIC via the i.n. route. The pigs in group 4 were injected with 1 × 109 CFU of S-8 via the i.n. route. The pigs in group 5, the control group, were inoculated with an equivalent amount of PBS via the i.n. route. The rectal temperature, appetite, respiratory rate, and lethargywere recorded daily for 14 days after inoculation as described previously [24]. Pigs that showed severe respiratory distress during the observation period were euthanized. All of surviving pigs were euthanized at day 14 post-challenge, and the lung lesions were examined and scored as described previously [25]. Briefly, the lung lesion was determined by divided the complete lung into seven lobes, each lobe was scored 1-5 by assessing the pneumonic area.

Protection studies in pigs

Twenty 4-week-old pigs were randomly assigned into four experimental groups (n = 5). The pigs in group 1 and group 3 were immunized via an intramuscular (i.m.) route with 1 × 107 CFU of S-8clpPapxIIC in 1 mL of PBS. The pigs in group 2 and group 4 were inoculated with 1 mL of PBS. The booster immunization was performed 21 days after the primary vaccination.

On day 14 following the booster immunization, the pigs in groups 1 and group 2 were challenged with 5.0 × 109 CFU of A. pleuropneumoniae homologous serovar 7 (S-8) via the i.n. route. The pigs in groups 3 and group 4 were challenged with 5.0 × 108 CFU of A. pleuropneumoniae heterologous serovar 5a (K17) via the i.n. route. After challenge, the pigs from each group were observed daily for clinical symptoms for 14-day period after challenge as previously described [24]. Pigs that showed severe respiratory distress during the observation period were euthanized. At day 14 post-challenge, all surviving pigs were euthanized and lung lesions were examined and scored as mentioned above [25].

Antibody measurements

Serum samples were collected from pigs in different groups before the first immunization (day 0), before the booster immunization (day 21) and before homologous or heterologous challenge (day 35). Antibodies against ApxII were examined using indirect ELISA as previously described [26]. 96-well plates were coated with 5 μg/mL of ApxII in 50 mM sodium carbonate buffer (pH 9.6) at 4 °C overnight. The wells were washed three times with PBST buffer (PBS supplemented with 0.05% Tween-20) and then blocked with PBS containing 5% bovine serum albumin at 37 °C for 1 h. Serum samples diluted in PBS were then added to the wells and incubated for 1 h at 37 °C. After the plates were washed, horseradish peroxidase (HRP)-conjugated goat anti-porcine IgG was diluted and added to the plates and incubated for 1 h at 37 °C. For determining the IgG isotypes, the sera were added to the S-8clpPapxIIC-coated plates and incubated with mouse anti-pig IgG1 Monoclonal Antibody (Clone K139 3C8, Thermo, United Kingdom) or mouse anti-pig IgG2 Monoclonal Antibody (Clone K68 Ig2, Thermo, United Kingdom), followed by HRP-conjugated goat anti-mouse IgG (Abcam, United Kingdom). After three washes, the substrate solution tetramethylbenzidine (TMB) and H2O2 were added to the wells and incubated for 15 min, and the reaction was stopped by the addition of 2 M sulfuric acid. The absorbance was measured at 450 nm using an ELISA reader. Each sample was tested in triplicate.

Determination of cytokines by ELISA

Serum samples at day 0, day 21, and day 35 were analyzed for swine gamma interferon (IFN-γ), interleukin 12 (IL-12) (R&D Systems, USA), and interleukin 4 (IL-4) (Invitrogen, USA) using ELISA kits performed according to the manufacturer’s instructions. Concentrations of swine IFN-γ, IL-12, and IL-4 in tested sera samples were determined by extrapolation to the linear portion of the standard curve, which was generated with supplied reference standards.

Bacterial loads analysis

Pigs from each group were necropsied immediately after euthanasia and lung tissues were aseptically collected. Samples were weighed, suspended in 1 mL PBS, and homogenized using a tissue homogenizer. The tissue homogenates were serially diluted with sterile PBS. Viable counts in serial dilutions of homogenates were determined following culture on TSA plates for 18 h at 37 °C. Identification of A. pleuropneumoniae was conducted by colony PCR assay and expressed as log10 CFU/g.

Statistical analysis

All statistical analyses were conducted using GraphPad Prism version 5.01 (GraphPad Software Inc., USA). Student’s t-test was used to evaluate the significance of the differences between multiple experimental groups. The data were expressed as the mean +/- standard deviation and values of P < 0.05 were considered to be significant.


Construction of the S-8clpPapxIIC mutant strain

To construct the double-deletion mutant S-8clpPapxIIC, we deleted the apxIIC gene of A. pleuropneumoniae S-8clpP mutant via the allelic exchange of the wild-type apxIIC gene with an unmarked, in-frame deletion lacking 270 bp of the apxIIC ORF (Fig. 1a and Fig. 1b). To test the stability of the in-frame deleted apxIIC gene in the genome of the A. pleuropneumoniae S-8clpPapxIIC mutant, a PCR assay was performed on the genomes of the mutant from 10 passages to detect a 294-bp DNA fragment characteristic of the in-frame deleted apxIIC. This fragment was observed in all 10 consecutive passages (Fig. 1c), suggesting a stable in-frame deletion in the S-8clpPapxIIC genome.
Figure 1
Fig. 1

Characterization of the A. pleuropneumoniae mutant S-8clpapxIIC. a Schematic representation of the A. pleuropneumoniae apxIIC locus. Binding locations for the primers IICLF/IICLR and IICRF/IICRR used to amplify the two flanking regions (1412 bp and 1443 bp, respectively) of the apxIIC gene were shown in the schematic, and primers IICJDF/IICJDR were used to identify the S-8clpapxIIC mutant (294 bp) and S-8clp mutant (564 bp). The shadowed domain represents a 270 bp in-frame deletion in the apxIIC gene, hp indicates the encoding gene of the hypothetical protein. b PCR identification of the S-8clpapxIIC mutant using the primers IICJDF/IICJDR. For lane 3, the identified S-8clpapxIIC mutant (294 bp); for other lanes, the single crossover mutant (564 bp and 294 bp). c PCR identification of the 10 passages of the S-8clpapxIIC mutant. For lanes 1–10, 10 successive passages of the S-8clpapxIIC mutant; for lane M, DL2000 DNA molecular marker (from top to bottom: 2000, 1000, 750, 500, 250, and 100 bp)

The growth curves of the S-8clpP mutant, the S-8clpPapxIIC mutant, and the wild-type strain S-8 were similar at 37 °C (Fig. 2a). The hemolytic assay was examined in the wild-type strain S-8, the S-8clpP mutant, and the S-8clpPapxIIC mutant. S-8 and the S-8clpP mutant with the integrated apxII operon had hemolytic activity, as shown by clear zones around the colonies (Fig. 2b). However, the clear zones were absent in the S-8clpPapxIIC mutant, the result of deletion of the apxIIC gene rendered it unable to activate ApxII toxin, and thus lacking hemolytic activity.
Figure 2
Fig. 2

Growth characteristics and hemolytic activities of the A. pleuropneumoniae mutants. a The growth curves of the S-8, S-8clp and S-8clpapxIIC strains. Overnight cultures were inoculated into fresh TSB and then incubated at 37 °C. Growth was monitored by OD600 at an interval of 1 h. b Hemolytic activity test for the S-8, S-8clp and S-8clpapxIIC strains. Section 1, S-8; section 2, S-8clp; section 3, S-8clpapxIIC

Virulence of the S-8clpP and S-8clpPapxIIC mutants in mice

The attenuation of virulence was investigated by determining the LD50 values of the S-8clpPapxIIC mutant, and the wild-type strain S-8 in BALB/c mice. The data showed LD50 values of 5.62 × 105 CFU per mouse for the wild-type strain S-8, and 1.12 × 109 CFU per mouse for the S-8clpPapxIIC mutant. Compared to the wild-type strain S-8, the S-8clpPapxIIC mutant was attenuated by approximately 1195-fold in mice. LD50 values showed that the S-8clpPapxIIC mutant was highly attenuated.

Virulence of the S-8clpPapxIIC mutant in pigs

The results of the safety study on the S-8clpPapxIIC mutant in pigs are listed in Table 3. Two of five pigs inoculated with 1.0 × 109 CFU of the S-8clpPapxIIC mutant via the i.n. route showed a slight increase in rectal temperatures (40.1 °C < body temperatures < 40.3 °C) after 8–20 h post-infection and exhibited only mild clinical symptoms of porcine pleuropneumonia, such as decreased appetite. However, all of these pigs recovered quickly in 24 h and were in good health afterward. All of the five pigs inoculated with 1.0 × 107 CFU of the S-8clpPapxIIC via the i.n. route exhibited no clinical signs of porcine pleuropneumonia. Compared to the groups inoculated with the S-8clpPapxIIC mutant, the groups inoculated with the S-8 strain exhibited more severe clinical symptoms of porcine pleuropneumonia. Three of five pigs which were inoculated with 1.0 × 109 CFU of S-8 were euthanized because of severe clinical symptoms. The lesions in their lungs were severe with massive hemorrhages and fibrinous inflammation was observed. Compared to serious lung lesions of pigs in the S-8-inoculated groups, there are no or few lung lesions in the pigs of the S-8clpPapxIIC-inoculated groups (Fig. 3). The average lung lesion scores were 16.2 for 1.0 × 107 CFU and 21.8 for 1.0 × 109 CFU of S-8 challenge. However, the groups inoculated with S-8clpPapxIIC showed significantly lower lung lesion scores, with 1.8 and 3.0 following challenge with 1.0 × 107 CFU or 1.0 × 109 CFU, respectively (Table 3).
Table 3

Virulence of the A. pleuropneumoniae S-8clpPapxIIC mutant in pigs


Strain for challenge

Challenge dose a (CFU)

Temperature (°C) b

Appetite c

Lethargy c

Dyspnea c

Lung lesion score d



1.0 × 107

39.2 ± 0.3

0.2 ± 0.4*

0.1 ± 0.2**

0.2 ± 0.2**

1.8 ± 3.0**



1.0 × 107

40.1 ± 0.4

1.8 ± 1.3

1.7 ± 0.7

1.9 ± 0.7

16.2 ± 8.5



1.0 × 109

39.4 ± 0.5

0.4 ± 0.5*

0.3 ± 0.3**

0.4 ± 0.4**

3.0 ± 2.2**



1.0 × 109

40.2 ± 0.6

2.4 ± 1.6

2.2 ± 0.6

2.5 ± 0.5

21.8 ± 5.8




39.4 ± 0.3





a Groups of five pigs were given intranasal inoculations with 1 mL of bacterial suspension containing various quantities of A. pleuropneumoniae strains. Survival was recorded for 14 days after infection

b The average temperature value for each piglet during the observation period was calculated and the mean temperature value for each group was determined

c Clinical signs were scored as described by Jolie et al [24]. Appetite was scored as follows: 0, did eat; and 1, did not eat. The total score equaled the number of 12-h periods of not eating over the 36-h observation period. Lethargy was scored as follows: 0, normal; 1, slight inactivity; 2, moderate; and 3, severe. Dyspnea was scored as follows: 0, normal; 1, slight; 2, moderate; and 3, severe. The final scores were obtained from the average of all of the data within the observation time and are expressed as arithmetic means ± SD; *, significance at a P value of <0.05; **, significance at a P value of <0.01

d The lung lesion score was determined as described by Hannan et al [25]

Figure 3
Fig. 3

Pathological changes of the lungs of pigs infected with A. pleuropneumoniae. Groups of pigs were inoculated with different doses of S-8 and S-8clpapxIIC. At 14 days post-infection, all pigs were euthanized and lungs were collected and subjected to pathological examination

Immune response of pigs to the S-8clpPapxIIC mutant

Serum samples from pigs of each group were obtained from blood via anterior vena cava venipuncture. Figure 4a showed a significant increase in antibody titers in pigs immunized with S-8clpPapxIIC on days 21 and 35, however, no antibody was detected in the PBS control groups. The IgG isotype was determined to check the specific antibody types against S-8clpPapxIIC. The levels of isotypes IgG1 and IgG2 in the immunized groups were significantly higher (P < 0.01) than that of PBS control groups (Fig. 4b, c).
Figure 4
Fig. 4

Levels of IgG antibody (a), IgG1 (b), and IgG2 (c) in the sera of piglets. Blood samples were collected prior to and following immunization on days 0, 21, and 35 from the S-8clpapxIIC immunized groups and PBS control groups, and the antibody responses were determined by indirect ELISA. The results are expressed as the means ± SD

Levels of IFN-γ in sera from S-8clpPapxIIC immunization groups were significantly higher than those of PBS control groups on days 21 and 35 (P < 0.01) (Fig. 5a). Levels of IL-12 in the S-8clpPapxIIC immunization groups were also significantly higher than those of control groups during the observation period (P < 0.01) (Fig. 5b). Both the IFN-γ and IL-12 concentrations in sera from S-8clpPapxIIC immunized animals increased substantially on day 21 and exhibited a smaller increase on day 35. While the IL-4 concentrations in sera from S-8clpPapxIIC immunized groups exhibited an approximately equal increase on day 21 and day 35, higher than in sera from the PBS control groups (P < 0.01) (Fig. 5c).
Figure 5
Fig. 5

Levels of IFN-γ, IL-12, and IL-4 in the sera of piglets. Blood samples were collected prior to and following immunization on days 0, 21, and 35 from the S-8clpapxIIC immunized groups and PBS control groups, and the levels of IFN-γ (a), IL-12 (b), and IL-4 (c) were determined by commercial kit. The results are expressed as the means ± SD

Protective efficacy in pigs

The protective efficacy of the S-8clpPapxIIC mutant against lethal challenge with A. pleuropneumoniae serovar 7 S-8 or serovar 5a K17 in pigs was evaluated in terms of body temperature, clinical signs, lung lesions, and survival rate. The results are summarized in Fig. 6 and Table 4. Pigs in the S-8clpPapxIIC-immunized groups showed slight or no lethargy, anorexia or dyspnea after challenge with A. pleuropneumoniae serovar 5a or serovar 7. Four immunized pigs had a transient increased body temperature (<40.3 °C) on day 0 upon challenge with A. pleuropneumoniae S-8 or K17 but recovered afterward. During the 14-day observation period, all immunized pigs survived with clinical symptoms ranging from none to only mild. All of the pigs in the PBS control groups developed anorexia, increased respiratory rate, and depression after challenge with A. pleuropneumoniae S-8 or K17. The average body temperature increased (41.2 °C) for at least 3 days. Four of ten pigs showed severe respiratory distress within 48 h and were euthanized. Three pigs subsequently exhibited severe respiratory distress during the next four days and were euthanized. Only two pigs challenged with S-8 and one pig challenged with K17 in the control groups survived over the 14-day observation period.
Figure 6
Fig. 6

Survival of pigs following intranasal challenge with A. pleuropneumoniae strains S-8 or K17

Table 4

Protective efficacy of the S-8clpapxIIC mutant against A. pleuropneumoniae S-8 and K17 challenge in pigs



Strain for challenge

Temperature (°C) a

Appetite b

Lethargy b

Dyspnea b

Lung lesion score c




39.4 ± 0.2

0.2 ± 0.3*

0.2 ± 0.3**

0.1 ± 0.2**

1.4 ± 2.2*




40.3 ± 0.5

2.4 ± 1.1

2.0 ± 0.6

2.3 ± 0.6

20.2 ± 11.9




39.6 ± 0.3

0.3 ± 0.4*

0.3 ± 0.4**

0.4 ± 0.4**

1.7 ± 2.5**




40.5 ± 0.4

2.6 ± 1.7

2.3 ± 0.5

2.6 ± 0.4

22.8 ± 9.3

a The average temperature value for each piglet during the observation period after challenge was calculated and the mean temperature value for each group was determined

b Clinical signs were scored as described by Jolie et al [24]. Appetite was scored as follows: 0, did eat; and 1, did not eat. The total score equaled the number of 12-h periods of not eating over the 36-h observation period. Lethargy was scored as follows: 0, normal; 1, slight inactivity; 2, moderate; and 3, severe. Dyspnea was scored as follows: 0, normal; 1, slight; 2, moderate; and 3, severe. The final scores were obtained from the average of all of the data within the observation time and are expressed as arithmetic means ± SD; *, significance at a P value of <0.05; **, significance at a P value of <0.01

c The lung lesion score was determined as described by Hannan et al [25]

At necropsy, the pigs in the PBS control groups showed severe lung lesions and pleuritis. Hemorrhage and fibrinous exudation on the lung and pleura were found in these pigs. The average lung lesion scores were 20.2 and 22.8 for challenge with A. pleuropneumoniae S-8 or K17, respectively. However, in comparison to the PBS control groups, the S-8clpPapxIIC-immunized groups showed significantly lower lung lesion scores of 1.4 and 1.8 for challenge with A. pleuropneumoniae S-8 or K17, respectively.

Bacteriological analysis of tissue homogenates

Bacterial loads in lung homogenates were counted after challenge with A. pleuropneumoniae S-8 or K17 (Fig. 7). The numbers of CFUs recovered from the homogenized lung tissues in S-8clpPapxIIC immunized groups were significantly lower (P < 0.01) than those of PBS control groups.
Figure 7
Fig. 7

Bacterial loads in lung homogenates after challenge with A. pleuropneumoniae strains S-8 or K17. The logarithm value (Log10) of the CFU in each gram of tissue sample was recorded. The immunized groups were vaccinated with S-8clpapxIIC and the PBS control groups were injected with PBS. The results are expressed as the means ± SD


With the growing emergence of drug resistance and the problem of antibiotic residues, vaccination becomes the most effective method of preventing A. pleuropneumoniae infection [7, 11]. Previous studies found that pigs surviving natural infection of A. pleuropneumoniae could be fully protected against homologous strain and partially against heterologous serovars, suggesting that live bacteria likely induced in vivo expression of protective antigens and conferred cross-protection [11]. Thus, an attenuated live vaccine is widely acknowledged as an ideal approach for vaccination against porcine pleuropneumonia.

The ideal live vaccine of porcine pleuropneumonia should be low virulent and cause minimum lung lesions [11]. Our previous study constructed S-8clpP, an A. pleuropneumoniae clpP gene deletion mutant, and illustrated the important function of the ClpP protease in the stress response and biofilm formation of A. pleuropneumoniae, suggesting a putative role for ClpP protease in the virulence regulation [17]. Afterwards, the virulence of S-8clpP was determined using the BALB/c mouse infection model. The finding that the S-8clpP moderately attenuated by approximately 71-fold (data not shown) was unexpected as a previous study had found that clpP deletion strains of S. typhimurium and S. enteritidis were attenuated by approximately 10,000-fold [16]. Thus, in this study, we further deleted the apxIIC gene that encodes the ApxII activating protein, and rendered the double-deletion mutant S-8clpPapxIIC secreting unactivated ApxII toxins but with complete antigenicity [18]. Compared to the wild-type strain, S-8clpPapxIIC was greatly attenuated by approximately 1195-fold. We next evaluated the virulence of S-8clpPapxIIC in pigs via intranasal inoculation, with the results showing that pigs inoculated with 1.0 × 107 CFU of the S-8clpP mutant displayed no clinical signs of porcine pleuropneumonia but exhibited only transient depression when inoculated with 1.0 × 109 CFU. Moreover, there are no or little lung lesions in the pigs of the S-8clpPapxIIC-inoculated group, which showed that the S-8clpPapxIIC mutant was adequately attenuated and has almost no detrimental effects on pigs that remained healthy throughout the experiment.

An essential characteristic for an effective attenuated live vaccine is that the strain should remain highly immunogenic [11]. Pigs vaccinated with the A. pleuropneumoniae S-8clpPapxIIC mutant exhibited a significantly increased ApxII-specific IgG Ab response compared to pigs injected with PBS. Interestingly, both A. pleuropneumoniae-specific IgG1 and IgG2 titers increased following the first immunization and booster immunization. The production of IgG isotypes in pig is elicited by type 1 (IFN-γ, IL-12) and type 2 (IL-4) cytokines, which lead the responses to a cell-mediated or antibody-mediated immune response [27]. In pigs, IgG2 is linked to the production of IFN-γ and IL-12 and correlates with the Th1 response [27, 28]. Conversely, the production of the specific IgG1 antibody partially relies on the presence of the Th2 cytokine IL-4 [29]. In this study, we also found that on day 35, the levels of IFN-γ, IL-12, and IL-4 were significantly higher in sera from S-8clpPapxIIC immunized pigs than those in sera from PBS control groups, but IL-4 concentrations were lower than IFN-γ and IL-12 concentrations in sera from the immunization groups. These data suggested that immunization with A. pleuropneumoniae S-8clpPapxIIC generated a slight bias towards the Th1-type immune response. However, the IgG1 titers and IL-4 concentrations in the S-8clpPapxIIC immunized pigs were still much higher than those in the PBS control groups. These data showed that the Th2-type immune response also plays a partial role in immunization with live A. pleuropneumoniae S-8clpPapxIIC. Unlike the other A. pleuropneumoniae live attenuated mutant that is significantly biased toward a Th1-type immune response [30], S-8clpPapxIIC generated a more balanced and broader immune response.

Cross-protection is a crucial characteristic that is important to achieve widespread use of a vaccine. Our findings demonstrated that immunization with the S-8clpPapxIIC mutant could induce acquired immunity and confer a marked resistance against the lethal challenge with A. pleuropneumoniae virulent homologous strain S-8 and heterologous serovar 5a. Although S-8clpPapxIIC exhibited good immune protection as a live vaccine, a few pigs after challenge still had few pathological lesions. As it is unlikely that the multiple-gene deleted mutant can revert back to the wild-type genotype, we will further delete other important virulence genes of A. pleuropneumoniae in our future studies and construct a multiple-gene deleted mutant as a safe, attenuated live vaccine to prevent and control A. pleuropneumoniae infection.


In conclusion, data presented in this study indicated that the immunizations with the candidate vaccine S-8clpPapxIIC were safe in pigs; and conferred efficient protection against the homologous or heterologous serovar infection. Overall, the S-8clpPapxIIC mutant of A. pleuropneumoniae has the potential as a novel live attenuated vaccine against porcine pleuropneumonia, although further trials are needed.


A. pleuropneumoniae

Actinobacillus pleuropneumoniae


Adenosine triphosphate


Colony-forming unit


Enzyme-linked immunosorbent assay


Gamma interferon


Immunoglobulin G


Interleukin 12


Interleukin 4




Lethal dose 50% value


Polymerase chain reaction

S. enteritidis

Salmonella enteritidis

S. typhimurium

Salmonella typhimurium


Single-overlap extension polymerase chain reaction


Tryptic soy agar


Tryptic soy broth



All the authors have seen and approved the content and have contributed significantly to the work.


This research was supported by grants from Special Fund for Agro-scientific Research in the Public Interest (201303034), National Natural Science Foundation of China (31100103), Natural Science Foundation of Heilongjiang Province of China (C2016067 and QC2016044), the project of Harbin Science and Technology innovative talents (2015RQQYJ073), and the State’s Key Project of Research and Development Plan (2016YFD0500700).

Availability of data and materials

The datasets used and/or analysed during the current study available from the corresponding author on reasonable request.

Authors’ contributions

SL and CW designed the experiments, FX and GL conducted experiments, LZ, YZ and NC performed the experiments, FX and LZ analyzed the data and drafted the manuscript, CW finalized the manuscript. All authors read and approved the final manuscript.

Competing interests

The authors declare that they have no competing interests.

Consent for publication

Not applicable.

Ethics approval and consent to participate

The animal experiment in this study was approved by the Animal Ethics Committee of Harbin Veterinary Research Institute of the Chinese Academy of Agricultural Sciences (CAAS) and carried out in strict accordance with animal ethics guidelines and approved protocols. The pigs used in the study were purchased from commercial farms, and the consent was obtained from the pigs’ owner(s) for them to be used.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (, which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver ( applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

State Key Laboratory of Veterinary Biotechnology, Division of Bacterial Diseases, Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Harbin, People’s Republic of China


  1. Fenwick B, Henry S. Porcine pleuropneumonia. J Am Vet Med Assoc. 1994;204:1334–40.PubMedGoogle Scholar
  2. Chiers K, De Waele T, Pasmans F, Ducatelle R, Haesebrouck F. Virulence factors of Actinobacillus pleuropneumoniae involved in colonization, persistence and induction of lesions in its porcine host. Vet Res. 2010;41:65.View ArticlePubMedPubMed CentralGoogle Scholar
  3. Bosse JT, Janson H, Sheehan BJ, Beddek AJ, Rycroft AN, Kroll JS, et al. Actinobacillus pleuropneumoniae: pathobiology and pathogenesis of infection. Microbes Infect. 2002;4:225–35.View ArticlePubMedGoogle Scholar
  4. Blackall PJ, Klaasen HL, van den Bosch H, Kuhnert P, Frey J. Proposal of a new serovar of Actinobacillus pleuropneumoniae: serovar 15. Vet Microbiol. 2002;84:47–52.View ArticlePubMedGoogle Scholar
  5. Sarkozi R, Makrai L, Fodor L. Identification of a proposed new serovar of Actinobacillus pleuropneumoniae: serovar 16. Acta Vet Hung. 2015;63:444–50.View ArticlePubMedGoogle Scholar
  6. Subashchandrabose S, Leveque RM, Kirkwood RN, Kiupel M, Mulks MH. The RNA chaperone Hfq promotes fitness of Actinobacillus pleuropneumoniae during porcine pleuropneumonia. Infect Immun. 2013;81:2952–61.View ArticlePubMedPubMed CentralGoogle Scholar
  7. Archambault M, Harel J, Goure J, Tremblay YD, Jacques M. Antimicrobial susceptibilities and resistance genes of Canadian isolates of Actinobacillus pleuropneumoniae. Microb Drug Resist. 2012;18:198–206.View ArticlePubMedGoogle Scholar
  8. Bosse JT, Li Y, Atherton TG, Walker S, Williamson SM, Rogers J, et al. Characterisation of a mobilisable plasmid conferring florfenicol and chloramphenicol resistance in Actinobacillus pleuropneumoniae. Vet Microbiol. 2015;178:279–82.View ArticlePubMedPubMed CentralGoogle Scholar
  9. Bosse JT, Li Y, Walker S, Atherton T, Fernandez Crespo R, Williamson SM, et al. Identification of dfrA14 in two distinct plasmids conferring trimethoprim resistance in Actinobacillus pleuropneumoniae. J Antimicrob Chemother. 2015;70:2217–22.View ArticlePubMedPubMed CentralGoogle Scholar
  10. Nielsen R. Haemophilus pleuropneumoniae serotypes--cross protection experiments. Nord Vet Med. 1984;36(7-8):221–34.PubMedGoogle Scholar
  11. Ramjeet M, Deslandes V, Goure J, Jacques M. Actinobacillus pleuropneumoniae vaccines: from bacterins to new insights into vaccination strategies. Anim Health Res Rev. 2008;9:25–45.View ArticlePubMedGoogle Scholar
  12. Maas A, Meens J, Baltes N, Hennig-Pauka I, Gerlach GF. Development of a DIVA subunit vaccine against Actinobacillus pleuropneumoniae infection. Vaccine. 2006;24:7226–37.View ArticlePubMedGoogle Scholar
  13. Thomsen LE, Olsen JE, Foster JW, Ingmer H. ClpP is involved in the stress response and degradation of misfolded proteins in salmonella enterica serovar typhimurium. Microbiology. 2002;148:2727–33.View ArticlePubMedGoogle Scholar
  14. Raju RM, Unnikrishnan M, Rubin DH, Krishnamoorthy V, Kandror O, Akopian TN, et al. Mycobacterium tuberculosis ClpP1 and ClpP2 function together in protein degradation and are required for viability in vitro and during infection. PLoS Pathog. 2012;8:e1002511.View ArticlePubMedPubMed CentralGoogle Scholar
  15. Frees D, Chastanet A, Qazi S, Sorensen K, Hill P, Msadek T, et al. Clp ATPases are required for stress tolerance, intracellular replication and biofilm formation in Staphylococcus aureus. Mol Microbiol. 2004;54:1445–62.View ArticlePubMedGoogle Scholar
  16. Tennant SM, Wang JY, Galen JE, Simon R, Pasetti MF, Gat O, et al. Engineering and preclinical evaluation of attenuated nontyphoidal salmonella strains serving as live oral vaccines and as reagent strains. Infect Immun. 2011;79:4175–85.View ArticlePubMedPubMed CentralGoogle Scholar
  17. Xie F, Zhang Y, Li G, Zhou L, Liu S, Wang C. The ClpP protease is required for the stress tolerance and biofilm formation in Actinobacillus pleuropneumoniae. PLoS One. 2013;8:e53600.View ArticlePubMedPubMed CentralGoogle Scholar
  18. Prideaux CT, Lenghaus C, Krywult J, Hodgson AL. Vaccination and protection of pigs against pleuropneumonia with a vaccine strain of Actinobacillus pleuropneumoniae produced by site-specific mutagenesis of the ApxII operon. Infect Immun. 1999;67:1962–66.PubMedPubMed CentralGoogle Scholar
  19. Baltes N, Tonpitak W, Hennig-Pauka I, Gruber AD, Gerlach GF. Actinobacillus pleuropneumoniae serotype 7 siderophore receptor FhuA is not required for virulence. FEMS Microbiol Lett. 2003;220:41–8.View ArticlePubMedGoogle Scholar
  20. Oswald W, Tonpitak W, Ohrt G, Gerlach G. A single-step transconjugation system for the introduction of unmarked deletions into Actinobacillus pleuropneumoniae serotype 7 using a sucrose sensitivity marker. FEMS Microbiol Lett. 1999;179:153–60.View ArticlePubMedGoogle Scholar
  21. Dehio C, Meyer M. Maintenance of broad-host-range incompatibility group P and group Q plasmids and transposition of Tn5 in Bartonella henselae following conjugal plasmid transfer from Escherichia coli. J Bacteriol. 1997;179:538–40.View ArticlePubMedPubMed CentralGoogle Scholar
  22. Spindler KR, Fang L, Moore ML, Hirsch GN, Brown CC, Kajon A. SJL/J mice are highly susceptible to infection by mouse adenovirus type 1. J Virol. 2001;75:12039–46.View ArticlePubMedPubMed CentralGoogle Scholar
  23. Finney DJ. Statistical methods in biological assays, 2nd ed. London: Charles Griffin & Company Limited; 1964.Google Scholar
  24. Jolie RA, Mulks MH, Thacker BJ. Cross-protection experiments in pigs vaccinated with Actinobacillus pleuropneumoniae subtypes 1A and 1B. Vet Microbiol. 1995;45:383–91.View ArticlePubMedGoogle Scholar
  25. Hannan PC, Bhogal BS, Fish JP. Tylosin tartrate and tiamutilin effects on experimental piglet pneumonia induced with pneumonic pig lung homogenate containing mycoplasmas, bacteria and viruses. Res Vet Sci. 1982;33:76–88.PubMedGoogle Scholar
  26. Nielsen R, van den Bosch JF, Plambeck T, Sorensen V, Nielsen JP. Evaluation of an indirect enzyme-linked immunosorbent assay (ELISA) for detection of antibodies to the Apx toxins of Actinobacillus pleuropneumoniae. Vet Microbiol. 2000;71:81–7.View ArticlePubMedGoogle Scholar
  27. Crawley A, Wilkie BN. Porcine Ig isotypes: function and molecular characteristics. Vaccine. 2003;21:2911–22.View ArticlePubMedGoogle Scholar
  28. Furesz SE, Wilkie BN, Mallard BA, Rosendal S, MacInnes JI. Anti-haemolysin IgG1 to IgG2 ratios correlate with haemolysin neutralization titres and lung lesion scores in Actinobacillus pleuropneumoniae infected pigs. Vaccine. 1998;16:1971–5.View ArticlePubMedGoogle Scholar
  29. Snapper CM, Paul WE. Interferon-gamma and B cell stimulatory factor-1 reciprocally regulate Ig isotype production. Science. 1987;236:944–7.View ArticlePubMedGoogle Scholar
  30. Fu S, Ou J, Zhang M, Xu J, Liu H, Liu J, et al. The live attenuated Actinobacillus pleuropneumoniae triple-deletion mutant DeltaapxIC DeltaapxIIC DeltaapxIV-ORF1 strain, SLW05, Immunizes pigs against lethal challenge with Haemophilus parasuis. Clin Vaccine Immunol. 2013;20:134–9.View ArticlePubMedPubMed CentralGoogle Scholar


© The Author(s). 2017
