Strains, plasmids, and primers | Characteristics or sequence | Source or reference |
---|---|---|
Strains | ||
E. coli β2155 | thrB1004 pro thi strA hsdS lacZ△M15 (F’ lacZ△M15 lacl q traD36 proA + proB +)△dap :: erm (Ermr))recA :: RPA-2-tet(Tcr)::Mu-km (Kmr) λpir | [21] |
A.pleuropneumoniae S-8 | A. pleuropneumoniae serotype 7 clinical isolate from the lung of a diseased pig in northern China | [17] |
A.pleuropneumoniae S-8△clpP | Unmarked clpP gene knockout mutant of A. pleuropneumoniae S-8 | [17] |
A.pleuropneumoniae S-8△clpP△apxIIC | Unmarked clpP/apxIIC genes knockout mutant of A. pleuropneumoniae S-8 | This work |
Plasmids | ||
pEMOC2 | Conjugative vector based on pBluescript SK with mob RP4, polycloning site, Cm r, and transcriptional fusion of the omlA promoter with the sacB gene | Accession no. AJ868288 [19] |
pEM△apxIIC | Conjugative vector pEMOC2 with a 270 bp deletion in the apxIIC gene which have a 1.4-kb upstream fragment and 1.4-kb downstream fragment | This work |
Primers | ||
IICLF | 5’ GCGTCGACATGACAACACCAATGATTGATTTAC 3’, upstream primer with internal SalI site (underlined) | This work |
IICLR | 5’ AATCCCCGAA AGCATCATCCCTCCCATTC 3’, downstream primer with reverse complement sequence(underlined) of sequence in bold from primer IICRF | This work |
IICRF | 5’ GGATGATGCT TTCGGGGATTCATCTCTATTG 3’, upstream primer with reverse complement sequence(underlined) of sequence in bold from primer IICLR | This work |
IICRR | 5’ TTGCGGCCGCGTTGTAATAAGTCCCGTAACACCAG 3’, downstream primer with internal NotI site (underlined) | This work |
IICJDF | 5’ GAAGAGCCATTACCCAACAAC 3’, upstream primer for identification of apxIIC gene deletion | This work |
IICJDR | 5’ ATACAATAGAGATGAATCCCCG 3’, downstream primer for identification of apxIIC gene deletion | This work |