Skip to main content

Table 1 Characteristics of bacterial strains, plasmids, and primers used in this study

From: Attenuated Actinobacillus pleuropneumoniae double-deletion mutant S-8∆clpP/apxIIC confers protection against homologous or heterologous strain challenge

Strains, plasmids, and primers Characteristics or sequence Source or reference
Strains
E. coli β2155 thrB1004 pro thi strA hsdS lacZM15 (F’ lacZM15 lacl q traD36 proA + proB +)dap :: erm (Ermr))recA :: RPA-2-tet(Tcr)::Mu-km (Kmr) λpir [21]
A.pleuropneumoniae S-8 A. pleuropneumoniae serotype 7 clinical isolate from the lung of a diseased pig in northern China [17]
A.pleuropneumoniae S-8clpP Unmarked clpP gene knockout mutant of A. pleuropneumoniae S-8 [17]
A.pleuropneumoniae S-8clpPapxIIC Unmarked clpP/apxIIC genes knockout mutant of A. pleuropneumoniae S-8 This work
Plasmids
 pEMOC2 Conjugative vector based on pBluescript SK with mob RP4, polycloning site, Cm r, and transcriptional fusion of the omlA promoter with the sacB gene Accession no. AJ868288
[19]
 pEMapxIIC Conjugative vector pEMOC2 with a 270 bp deletion in the apxIIC gene which have a 1.4-kb upstream fragment and 1.4-kb downstream fragment This work
Primers
 IICLF 5’ GCGTCGACATGACAACACCAATGATTGATTTAC 3’, upstream primer with internal SalI site (underlined) This work
 IICLR 5’ AATCCCCGAA AGCATCATCCCTCCCATTC 3’, downstream primer with reverse complement sequence(underlined) of sequence in bold from primer IICRF This work
 IICRF 5’ GGATGATGCT TTCGGGGATTCATCTCTATTG 3’, upstream primer with reverse complement sequence(underlined) of sequence in bold from primer IICLR This work
 IICRR 5’ TTGCGGCCGCGTTGTAATAAGTCCCGTAACACCAG 3’, downstream primer with internal NotI site (underlined) This work
 IICJDF 5’ GAAGAGCCATTACCCAACAAC 3’, upstream primer for identification of apxIIC gene deletion This work
 IICJDR 5’ ATACAATAGAGATGAATCCCCG 3’, downstream primer for identification of apxIIC gene deletion This work