Skip to content

Advertisement

  • Research article
  • Open Access

Fibroblast growth factor-1 as a mediator of paracrine effects of canine adipose tissue-derived mesenchymal stem cells on in vitro-induced insulin resistance models

Contributed equally
BMC Veterinary Research201814:351

https://doi.org/10.1186/s12917-018-1671-1

  • Received: 1 September 2017
  • Accepted: 25 October 2018
  • Published:

Abstract

Background

In the field of diabetes research, many studies on cell therapy have been conducted using mesenchymal stem cells. This research was intended to shed light on the influence of canine adipose-tissue-derived mesenchymal stem cell conditioned medium (cAT-MSC CM) on in vitro insulin resistance models that were induced in differentiated 3T3-L1 adipocytes and the possible mechanisms involved in the phenomenon.

Results

Gene expression levels of insulin receptor substrate-1 (IRS-1) and glucose transporter type 4 (GLUT4) were used as indicators of insulin resistance. Relative protein expression levels of IRS-1 and GLUT4 were augmented in the cAT-MSC CM treatment group compared to insulin resistance models, indicating beneficial effects of cAT-MSC to DM, probably by actions of secreting factors. With reference to previous studies on fibroblast growth factor-1 (FGF1), we proposed FGF1 as a key contributing factor to the mechanism of action. We added anti-FGF1 neutralizing antibody to the CM-treated insulin resistance models. As a result, significantly diminished protein levels of IRS-1 and GLUT4 were observed, supporting our assumption. Similar results were observed in glucose uptake assay.

Conclusions

Accordingly, this study advocated the potential of FGF-1 from cAT-MSC CM as an alternative insulin sensitizer and discovered a signalling factor associated with the paracrine effects of cAT-MSC.

Keywords

  • Fibroblast growth factor-1
  • Canine
  • Adipose tissue
  • Mesenchymal stem cells
  • Conditioned medium
  • Diabetes mellitus
  • Insulin resistance
  • In vitro
  • 3T3-L1

Background

Diabetes mellitus (DM) is an important endocrine disease that accounts for a serious proportion of small animal medicine. In dogs, most DM patients are known to be type 1 DM (T1DM), which is usually well managed by exogenous insulin supplements. However, canine DM with insulin resistance, ‘poorly controlled T1DM’, not only needs expensive treatment, but also has poor prognosis. Several reports advocate that concurrent diseases such as obesity and inflammatory diseases are associated with insulin resistance in human DM patients [14]. A study in dogs also asserts the obesity is a cause of insulin resistance [5, 6]. However, the exact pathophysiology of insulin resistance development is not fully understood. Although insulin sensitizers could be an option for the treatment of uncontrolled T1DM, their possible adverse effects such as weight gain, bone loss, and congestive heart failure encourage further effort to develop new strategy for insulin resistance [7].

Mesenchymal stem cells (MSCs) are multipotent stromal cells that have immunomodulatory and regenerative effects. Because they are relatively free from ethical issues, their therapeutic uses for various diseases including DM have been studied globally. Many studies have shown that they have advantageous effects in in vivo experiments using diabetic rodent models [813]. Until now, the known mechanisms of MSC actions when applied to DM are as follows: to differentiate directly into insulin-producing cells (IPCs), to regulate the immune system, and to secrete beneficial cytokines and growth factors [14]. In particular, the paracrine effects of MSCs are thought to enhance insulin sensitivity [15].

Fibroblast growth factor-1 (FGF1) which is a member of the FGF family has been known to play crucial role in glucose homeostasis [16]. Perry et al. reported that FGF1 and FGF19 improved glucose metabolism via down regulation of the hypothalamic-pituitary-adrenal axis [17]. It has been documented that exogenous recombinant FGF1 (rFGF1) improved insulin sensitivity as well as normalized blood glucose levels in diabetic mice models [18]. Recently, FGF1 is getting attention as a leading candidate of novel insulin sensitizer.

This study was designed to investigate the effects of canine adipose tissue-derived MSC-conditioned medium (cAT-MSC CM) on an in vitro induced insulin resistance model. To explore this, gene expression of markers related to glucose uptake were evaluated and the specific effective factors were discovered.

Results

Characterization of cAT-MSCs

Cells obtained from canine adipose tissue were characterized by their ability to express stem cell markers and to differentiate toward adipogenic, osteogenic, and chondrogenic lineages when cultured in media containing lineage-specific factors. The known MSC markers such as CD29, CD73, CD44, and CD90 were highly expressed by the cells. Negative markers such as CD31, CD34, and CD45 were not expressed (Fig. 1a). The multi-lineage plasticity of cAT-MSCs was confirmed by specific staining methods: Oil Red O staining, Alizarin Red S staining, and Alcian Blue staining, respectively (Fig. 1b).
Fig. 1
Fig. 1

Flow cytometry and special staining characterized cAT-MSCs. a Immunophenotypic analysis was performed by flow cytometry using positive markers CD29, CD73, CD44, and CD90 and negative markers CD31, CD34, and CD45. b Adipogenic (Oil Red O staining), osteogenic (Alizarin Red S staining), and chondrogenic (Alcian Blue staining) differentiation abilities of cAT-MSCs (from left to right) were confirmed. Original magnification: 400x (left), 200x (middle, right)

Differentiation into adipocytes and development of an insulin resistance model in 3T3-L1 adipocytes

All processes of differentiation and induction of insulin resistance in the 3T3-L1 are depicted schematically in Fig. 2a. During differentiation, 3T3-L1 pre-adipocytes transformed from a fibroblast-like appearance to an adipocyte-like appearance and cytoplasmic lipid droplet accumulation became remarkable (Fig. 2b-d). After over 70% of 3T3-L1 cells differentiated, cells were treated with TNF-α and incubated in hypoxic conditions for 24 h to induce insulin resistance. The mRNA expression levels of IRS-1 and GLUT4 were compared as markers of insulin resistance. As a result, both IRS-1 and GLUT4 mRNA levels showed similar tendencies through the differentiation to insulin resistance induction, but the degree of alterations was greater in GLUT4. The mRNA expression levels of insulin resistance markers were remarkably increased during the differentiation, while they were markedly decreased in the insulin resistance model (Fig. 2e, f).
Fig. 2
Fig. 2

Insulin resistance was induced in 3T3-L1 adipocytes in vitro. a Adipocyte differentiation of 3T3-L1 cells and following induction of insulin resistance were summarized with the course of time. b Fibroblast-like 3T3-L1 pre-adipocytes at day 0. c Differentiating 3T3-L1 cells at day 3. d Differentiated 3T3-L1 adipocytes containing cytoplasmic lipid droplets at day 9. Original magnification: 200x. e, f Alterations in mRNA expression levels of IRS-1 and GLUT4 during the differentiation and insulin resistance induction were shown. Results are presented as mean ± SD obtained from three independent experiments *P < 0.05, **P < 0.01

Effects of cAT-MSC CM treatment on IRS-1 and GLUT4 expressions in the insulin resistance model

To evaluate the therapeutic effects of cAT-MSC CM on the insulin resistance model, the expression levels of IRS-1 and GLUT4 were examined by qRT-PCR and western blot analysis. Both IRS-1 and GLUT-4 mRNA expression levels were significantly increased after cAT-MSC CM treatment in the insulin resistance model (Fig. 3a, b). Similar results were observed in protein analysis (Fig. 3c-e, Additional file 1: Figure S1).
Fig. 3
Fig. 3

Treatment of cAT-MSC CM affected gene expressions of IRS-1 and GLUT4 in 3T3-L1 insulin resistance models. a, b The mRNA expression levels of IRS-1 and GLUT4 were elevated significantly in CM-treated insulin resistance models. c Western blot. d, e Up regulation of IRS-1 and GLUT4 protein expression was observed in CM-treated insulin resistance models. (−): insulin resistance models of 3T3-L1 cells, cAT-MSC CM: cAT-MSC CM-treated insulin resistance models of 3T3-L1 cells. Results are presented as mean ± SD obtained from three independent experiments *P < 0.05, **P < 0.01

Reduced therapeutic effects of cAT-MSC CM with anti-FGF1 neutralizing antibody treatment

We suspected that FGF1 in the cAT-MSC CM played an important role in the alterations in the expression levels of IRS-1 and GLUT4. To verify our hypothesis, we measured FGF-1 concentrations in DMEM and cAT-MSC CM by ELISA. FGF-1 concentrations were significantly increased in cAT-MSC CM compared to DMEM (Fig. 4a). Moreover, added an anti-FGF1 neutralizing antibody to the cAT-MSC CM treated insulin resistance model. By measuring the protein levels of insulin resistance markers and evaluating glucose uptake abilities, we confirmed that the improvement of expression levels of IRS-1, GLUT4 (Fig. 4b-d), and glucose uptake ability (Fig. 5, Additional file 1: Figure S1) were significantly reduced after anti-FGF1 neutralizing antibody treatment compare to cAT-MSC CM treated group.
Fig. 4
Fig. 4

Protein expressions of IRS-1 and GLUT4 were down regulated in differentiated 3T3-L1 adipocytes after blocking of FGF1 function. a FGF-1 concentrations in cAT-MSC CM and DMEM were measured by ELISA assay. b Protein expression levels of GLUT4 and IRS-1 were analysed by western blot. c, d Relative protein levels of IRS-1 and GLUT4 were lower in the insulin resistance models treated with both cAT-MSC CM and anti-FGF1 antibody than the models treated with cAT-MSC CM alone. Naïve: differentiated 3T3-L1 cells, (−): insulin resistance models of 3T3-L1 cells, cAT-MSC CM: cAT-MSC CM-treated insulin resistance models of 3T3-L1 cells, cAT-MSC CM + Ab: cAT-MSC CM- and anti-FGF1 antibody-treated insulin resistance models. Results are presented as mean ± SD obtained from three independent experiments *P < 0.05, **P < 0.01

Fig. 5
Fig. 5

Effect of FGF-1 on 2-DG glucose uptake in insulin resistance models of 3T3-L1 cells. Naïve: differentiated 3T3-L1 cells, (−): insulin resistance models of 3T3-L1 cells, cAT-MSC CM: cAT-MSC CM-treated insulin resistance models of 3T3-L1 cells, cAT-MSC CM + Ab: cAT-MSC CM- and anti-FGF1 antibody-treated insulin resistance models. Results are presented as mean ± SD obtained from three independent experiments *P < 0.05, **P < 0.01

Discussion

There have been doubts that exogenous insulin supplements for poorly controlled T1DM or T2DM were not enough to maintain the patient in a good condition. In this regard, researches into cell therapy using MSCs have been actively conducted. Mechanisms of their therapeutic effects to DM may be explained through various molecular processes. MSCs have the ability to directly differentiate into IPCs [1921] and regulate the immune system to protect pancreatic islet cells from further destruction [2226]. In addition, they possess powerful paracrine effects via secretion of a variety of cytokines and growth factors, enabling them to have anti-inflammatory effects and regulate insulin signalling and resulting in the improvement of insulin sensitivity [15, 2729]. Several insulin sensitizers (such as biguanides and thiazolidinediones) were considered as therapeutics for DM with insulin resistance. However, long-term medication with these drugs can cause various adverse effects, which highlights the necessity for a new strategy.

In these experiments, we used 3T3-L1 adipocytes to develop an in vitro insulin resistance model. There have been diverse studies into inducing insulin resistance in 3T3-L1 cell lines. For example, various agents including TNF-α, Interleukin-1 (IL-1), IL-6, free fatty acids, dexamethasone, and high insulin were used to make models of insulin resistance in 3T3-L1 adipocytes [3035]. Lo et al. compared transcriptome analysis data of in vitro insulin resistance models and in vivo diet-induced obese mouse models. Considering their finding that the TNF-α and hypoxia co-treatment model most closely resembled in vivo alterations [36], we employed this model in our experiment. For the purpose of monitoring insulin resistance, we selected IRS-1 and GLUT4 as markers of glucose uptake ability [37, 38]. IRS-1 is a signalling protein that plays an important role at the initial part of insulin signalling pathway [39]. GLUT4 is a transporter protein that is mainly expressed in the skeletal muscle, adipose tissue, and heart [40]. Its up regulation and translocation to the cell membranes are thought to be critical steps of the insulin responsive increment of glucose uptake [41].

According to early studies, the effectiveness of MSC in DM originated from the potential to trans-differentiation towards IPCs [42, 43]. However, these theories were unable to give a good explanation for the disappointing results of in vivo cell tracking studies [44, 45]. Recent studies suggested that the secretory capacity of MSCs would play a crucial role for the therapeutic effects. Gao et al. isolated and injured pancreatic islets in vitro and then assessed islet regeneration after the treatment with MSC CM. They found that both β cell replication and islet progenitor differentiation were promoted and the PI3K / Akt signal pathway was involved [46]. Another study revealed that AT-MSC CM enhanced glucose uptake in 3T3-L1 and C2C12 insulin resistance models [47]. We also utilized cAT-MSC CM to explore the paracrine effect of cAT-MSC in our experiments.

FGF family is a signalling protein group composed of 18 members mediating a variety of biological functions in cell proliferation and developmental processes. Each family member performs unique actions by binding to FGF receptors, which results in activation of intracellular downstream cascades [48]. FGF1, identified as a regulator of adipose tissue remodelling and metabolic homeostasis, is a downstream molecule of peroxisome proliferator-activated receptor-γ (PPAR-γ), which is a target of the thiazolidinedione class of insulin sensitizers [49]. It has been established that rFGF1 injection normalized glucose levels and enhanced insulin sensitivity in diabetic mice. What was noteworthy is that the effect was insulin-dependent. Moreover, rFGF1 did not induce side effects that could be incurred by chronic use of traditional insulin sensitizers. Furthermore, genetically modified rFGF1 lacking the mitogen properties of rFGF1 had similar glucose lowering effects to some extent [18], intensifying the possibility of rFGF1 as a substitute of conventional insulin sensitizers. Based on the fact that MSC CM contains considerable amounts of FGF1 [50], we attempted to find out whether FGF1 from cAT-MSC CM was contributed to the advantageous effects of cAT-MSC CM on insulin resistant models.

In the present study, we evaluated gene expression levels of IRS-1 and GLUT4, which were considered as markers of insulin responsive glucose uptake. It was shown that reduced expression levels of these markers in 3T3-L1 insulin resistance models were restored after the treatment of cAT-MSC CM. This finding was consistent with previous research that suggested that MSC could improve insulin resistance through the paracrine signalling of various cytokines and growth factors [47]. Since we suspected FGF1 would have a role in this effect, we measured FGF1 concentrations in cAT-MSC CM and added an anti-FGF1 neutralizing antibody into CM-treated 3T3-L1 insulin resistance models and assessed alterations of glucose uptake levels. The anti-FGF1 antibody group represented diminished expression levels of insulin resistance markers in comparison to the CM-treated group. This information led to the inference that FGF1 included in cAT-MSC CM is one of the mediators of the signalling pathways that induces therapeutic effects. Although we could not exclude the possibility that various cytokines and growth factors abundantly contained in cAT-MSC CM (other than FGF1) could affect the alterations in expression levels, it is worth mentioning that this study is the first work that revealed FGF1 as a specific mediator of insulin-sensitizing effects of cAT-MSC CM in DM.

Conclusions

We identified that the induced insulin resistance in 3T3-L1 cells was ameliorated in the presence of cAT-MSC CM by measuring mRNA and protein expression levels of IRS-1 and GLUT4. Additional data showed that the improvement was inhibited by the addition of anti-FGF1 neutralizing antibody, suggesting that FGF1 would act as a mediator of the beneficial effects of cAT-MSC CM. It is noteworthy that the present study is the first to reveal a specific functioning component of MSC CM in in vitro insulin resistance models, and further studies to find out other effective factors of MSC CM will be necessary.

Methods

Cell culture and characterization

Adipose tissue was obtained from three healthy dogs (1-year-old) during ovariohysterectomy at the Seoul National University Veterinary Medicine Teaching Hospital (SNU VMTH). The owners were provided an informed, written consent for research use. The procedure was also approved by the Institutional Animal Care and Use Committee (IACUC) of SNU and the protocol was performed in accordance with the approved guidelines. Canine adipose tissue-derived mesenchymal stem cells (cAT-MSCs) were isolated and cultured as previously described [51]. Before their use in this study, cells were characterized by their ability to express several stem cell markers using flow cytometry. Cells were suspended in 30 μl DPBS and 3 μl monoclonal antibodies against the following proteins: cluster of differentiation (CD) 29-Fluorescein isothiocyanate (FITC), CD31-FITC, CD34-phycoerythrin (PE), CD73-PE (BD Biosciences, Franklin Lakes, NJ, USA), CD44-FITC, CD45-FITC, and CD90-allophycocyanin (APC) (eBiosciences, San Diego, CA, USA)-conjugated antibodies. Non-stained cells were used as controls for autofluorescence. Cells were analysed by a BD FACSAria II system (BD Biosciences). Cellular differentiation was confirmed using PRIME-XV® Chondrogenic Differentiation Xeno-Free Serum-Free Medium (XSFM), PRIME-XV® Osteogenic Differentiation Serum-Free Medium (SFM), and PRIME-XV® Adipogenic Differentiation SFM (all from Irvine Scientific, Santa Ana, CA, USA) according to the manufacturer’s instructions followed by Alcian Blue staining, Alizarin Red staining, and Oil Red O staining, respectively.

In vitro cellular insulin resistance models

The in vitro induced insulin resistance model was developed in differentiated 3T3-L1 adipocytes. Murine 3T3-L1 cells were purchased from the Korean Cell Line Bank (Seoul, Korea). 3T3-L1 pre-adipocytes were differentiated using 3T3-L1 Differentiation Kit (Sigma-Aldrich) and all the differentiation procedures performed following the manufacturer’s instructions. In brief, 3 × 105 cells were seeded in 6 well cell culture plate (SPL Life Science, Pocheon, Korea) and reached 70%, induction of insulin resistance was initiated. Cells were washed with phosphate-buffered saline (PBS; PAN Biotech, Aidenbach, Germany) and changed to serum-free Dulbecco’s modified Eagle’s medium: Nutrient Mixture F-12 (1:1) (DMEM / F12 (1:1); PAN Biotech). Insulin resistance was induced with treatment with both 40 ng/mL of tumour necrosis factor-α (TNF-α; PeproTech, Rocky Hill, NJ, USA) and 1% oxygen for 24 h. For hypoxic incubation, cells were placed in a hypoxic incubator (ViVAGEN, Sungnam, Korea) with the conditions of 1% O2 at 37 °C.

Preparation of cAT-MSC-conditioned medium (CM), and anti-fibroblast growth factor-1 (FGF1) antibody treatment

cAT-MSCs (3 × 105 cells / well) were seeded in 6-well plates and cultured in 3 mL of DMEM medium containing 2% fetal bovine serum (FBS; PAN Biotech) for 3 days, yielding conditioned medium. After 3 days, conditioned medium was harvested and centrifuged at 850 rpm for 3 min to remove cellular debris. After centrifugation, the supernatant was transferred to a conical tube and stored at − 80 °C until use. In addition, the concentration of FGF-1 in the cAT-MSC CM were determined by Fibroblast Growth Factor 1 ELISA Kit (Mybiosource, San Diego, CA, USA) according to the manufacturer’s instructions. Anti-FGF1 neutralizing antibody (Abcam, Cambridge, MA, USA) was added to final concentrations of 0.9 μg / ml of culture medium.

RNA extraction, cDNA synthesis, and quantitative reverse-transcription PCR

Total RNA was extracted from all groups using the Easy-BLUE Total RNA Extraction kit (Intron Biotechnology, Seongnam, Korea) according to the manufacturer’s instructions. cDNA was synthesized from 1 μg of total RNA with LaboPass M-MuLV Reverse Transcriptase (Cosmo Genetech, Seoul, Korea) and the samples were analyzed in triplicates using AMPIGENE qPCR Green Mix Hi-ROX with SYBR Green dye (Enzo Life Sciences, Farmingdale, NY, USA). The expressions of target genes were analyzed according to the 2−ΔΔ/Cts method and normalized to mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Primer sequences used in this study are listed in Table 1.
Table 1

List of primer for qRT-PCR

Gene

Forward (5′-3′)

Reverse (5′-3′)

GAPDH

AGTATGTCGTGGAGTCTACTGGTGT

AGTGAGTTGTCATATTTCTCGTGGT

GLUT4

CCCAGTGAGTCTGTCATCTAGTAGT

GGACTAGAACCATACTCATCAGAAG

IRS-1

GAACACTGGTCCTAGCTGTATTCTC

GTAGCTCTGTTCAATCACCTTCTGT

Western blot analysis

Total proteins were extracted from all cell groups using PRO-PREP Protein Extraction Solution (Intron Biotechnology) according to the manufacturer’s instructions. The concentrations of the protein samples were measured using the Bio-Rad DC Protein Assay Kit (Bio-Rad, Hercules, CA, USA). The 30 μg of proteins were loaded and separated by sodium dodecyl sulphate-polyacrylamide gel electrophoresis and transferred to polyvinylidene difluoride membranes (Millipore, Billerica, MA, USA). The membranes were blocked by 5% non-fat dry milk in Tris-buffered saline containing 0.1% Tween 20 and incubated with primary antibodies against insulin receptor substrate 1 (IRS-1, 1:500; Abcam) and glucose transporter type 4 (GLUT4, 1:500; Santa Cruz Biotechnology, Santa Cruz, CA, USA) at 4 °C overnight. The membranes were incubated with secondary antibodies at room temperature for 1 h. The immunoreactive bands were visualised using enhanced chemiluminescence (Advansta, Menlo Park, CA, USA) and normalised to β-actin levels (Santa Cruz Biotechnology).

2-Deoxyglucose (2-DG) uptake assay

The differentiated 3T3-L1 adipocytes were treated with TNF-α and incubated in hypoxia for 24 h. After that, the 2-DG concentration was measured by Glucose Uptake Assay Kit (Abcam) according to the manufacturer’s instructions. Measurements were performed at least three replicates and then averaged.

Statistical analysis

Data are shown as mean ± standard deviation. Statistical comparisons between groups were made with use of one-way ANOVA and an unpaired Student’s t test using the GraphPad Prism v.6.01 software (GraphPad Inc., La Jolla, CA, USA). P value of < 0.05 was considered statistically significant.

Notes

Declarations

Acknowledgements

We are very thankful to Research Institute for Veterinary Science and the BK21 PLUS Program for Creative Veterinary Science Research.

Funding

This study was supported by the Research Institute for Veterinary Science and the BK21 PLUS Program for Creative Veterinary Science Research; this includes design of study, and collection, analysis, and interpretation of data, and writing of manuscript.

Availability of data and materials

The datasets used and/or analysed during the current study available from the corresponding author on reasonable request.

Authors’ contributions

H-JK, QL, and W-JS designed the study, performed the experiments, analysed the data, and wrote the manuscript. H-MY, S-YK, and S-CP collected and analysed the data. J-OA analysed the data and edited the manuscript. H-YY designed and supervised the study. All authors read and approved the final manuscript.

Ethics approval and consent to participate

Canine adipose tissue was obtained from a 1-year-old dog and the owner provided an informed, written consent for research use. The procedures involving animals were approved by the Institutional Animal Care and Use Committee (IACUC) of Seoul National University (protocol no. SNU-180706-2), and the protocols were performed in accordance with approved guidelines.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Department of Veterinary Internal Medicine, College of Veterinary Medicine, Seoul National University, Seoul, 08826, Republic of Korea
(2)
Current Address: Department of Veterinary Internal Medicine, College of Veterinary Medicine, Kangwon National University, Chuncheon, 24341, Gangwondo, Republic of Korea

References

  1. Xu H, Barnes GT, Yang Q, Tan G, Yang D, Chou CJ, Sole J, Nichols A, Ross JS, Tartaglia LA. Chronic inflammation in fat plays a crucial role in the development of obesity-related insulin resistance. J Clin Investig. 2003;112(12):1821.View ArticleGoogle Scholar
  2. Festa A, D’agostino R, Howard G, Mykkänen L, Tracy RP, Haffner SM. Chronic subclinical inflammation as part of the insulin resistance syndrome. Circulation. 2000;102(1):42–7.View ArticleGoogle Scholar
  3. Shoelson SE, Lee J, Goldfine AB. Inflammation and insulin resistance. J Clin Investig. 2006;116(7):1793.View ArticleGoogle Scholar
  4. Dandona P, Aljada A, Bandyopadhyay A. Inflammation: the link between insulin resistance, obesity and diabetes. Trends Immunol. 2004;25(1):4–7.View ArticleGoogle Scholar
  5. German AJ. The growing problem of obesity in dogs and cats. J Nutr. 2006;136(7):1940S–6S.View ArticleGoogle Scholar
  6. German AJ, Hervera M, Hunter L, Holden SL, Morris PJ, Biourge V, Trayhurn P. Improvement in insulin resistance and reduction in plasma inflammatory adipokines after weight loss in obese dogs. Domest Anim Endocrinol. 2009;37(4):214–26.View ArticleGoogle Scholar
  7. Lehrke M, Lazar MA. The many faces of PPARγ. Cell. 2005;123(6):993–9.View ArticleGoogle Scholar
  8. Bhansali A, Upreti V, Khandelwal N, Marwaha N, Gupta V, Sachdeva N, Sharma R, Saluja K, Dutta P, Walia R. Efficacy of autologous bone marrow–derived stem cell transplantation in patients with type 2 diabetes mellitus. Stem Cells Dev. 2009;18(10):1407–16.View ArticleGoogle Scholar
  9. Czubak P, Bojarska-Junak A, Tabarkiewicz J, Putowski L. A modified method of insulin producing cells’ generation from bone marrow-derived mesenchymal stem cells. J Diabetes Res. 2014;2014:628591.View ArticleGoogle Scholar
  10. Gabr MM, Zakaria MM, Refaie AF, Khater SM, Ashamallah SA, Ismail AM, El-Halawani SM, Ghoneim MA. Differentiation of human bone marrow-derived mesenchymal stem cells into insulin-producing cells: evidence for further maturation in vivo. Biomed Res Int. 2015;2015:1–10.View ArticleGoogle Scholar
  11. Hao H, Liu J, Shen J, Zhao Y, Liu H, Hou Q, Tong C, Ti D, Dong L, Cheng Y. Multiple intravenous infusions of bone marrow mesenchymal stem cells reverse hyperglycemia in experimental type 2 diabetes rats. Biochem Biophys Res Commun. 2013;436(3):418–23.View ArticleGoogle Scholar
  12. Kadam S, Govindasamy V, Bhonde R. Generation of functional islets from human umbilical cord and placenta derived mesenchymal stem cells. Methods Mol Biol. 2012;879:291–313.View ArticleGoogle Scholar
  13. Kadam SS, Bhonde RR. Islet neogenesis from the constitutively nestin expressing human umbilical cord matrix derived mesenchymal stem cells. Islets. 2010;2(2):112–20.View ArticleGoogle Scholar
  14. Zang L, Hao H, Liu J, Li Y, Han W, Mu Y. Mesenchymal stem cell therapy in type 2 diabetes mellitus. Diabetol Metab Syndr. 2017;9(1):36.View ArticleGoogle Scholar
  15. Si Y, Zhao Y, Hao J, Liu J, Guo Y, Mu Y, Shen J, Cheng Y, Fu X, Han W. Infusion of mesenchymal stem cells ameliorates hyperglycemia in type 2 diabetic rats: identification of a novel role in improving insulin sensitivity. Diabetes. 2012;61(6):1616–25.View ArticleGoogle Scholar
  16. Nies VJM, Sancar G, Liu W, Van Zutphen T, Struik D, Yu RT, Atkins AR, Evans RM, Jonker JW, Downes MR. Fibroblast growth factor signaling in metabolic regulation. Front Endocrinol. 2016;6(JAN):193.Google Scholar
  17. Perry RJ, Lee S, Ma L, Zhang D, Schlessinger J, Shulman GI. FGF1 and FGF19 verse diabetes by suppression of the hypothalamic-pituitary-adrenal axis. Nat Commun. 2015;6:6980.Google Scholar
  18. Suh JM, Jonker JW, Ahmadian M, Goetz R, Lackey D, Osborn O, Huang Z, Liu W, Yoshihara E, van Dijk TH. Endocrinization of FGF1 produces a neomorphic and potent insulin sensitizer. Nature. 2014;513(7518):436–9.View ArticleGoogle Scholar
  19. Hess D, Li L, Martin M, Sakano S, Hill D, Strutt B, Thyssen S, Gray DA, Bhatia M. Bone marrow-derived stem cells initiate pancreatic regeneration. Nat Biotechnol. 2003;21(7):763.View ArticleGoogle Scholar
  20. Xie Q-P, Huang H, Xu B, Dong X, Gao S-L, Zhang B, Wu Y-L. Human bone marrow mesenchymal stem cells differentiate into insulin-producing cells upon microenvironmental manipulation in vitro. Differentiation. 2009;77(5):483–91.View ArticleGoogle Scholar
  21. Kadam S, Muthyala S, Nair P, Bhonde R. Human placenta-derived mesenchymal stem cells and islet-like cell clusters generated from these cells as a novel source for stem cell therapy in diabetes. Rev Diabet Stud. 2010;7(2):168.View ArticleGoogle Scholar
  22. Ebato C, Uchida T, Arakawa M, Komatsu M, Ueno T, Komiya K, Azuma K, Hirose T, Tanaka K, Kominami E. Autophagy is important in islet homeostasis and compensatory increase of beta cell mass in response to high-fat diet. Cell Metab. 2008;8(4):325–32.View ArticleGoogle Scholar
  23. Zhao K, Hao H, Liu J, Tong C, Cheng Y, Xie Z, Zang L, Mu Y, Han W. Bone marrow-derived mesenchymal stem cells ameliorate chronic high glucose-induced β-cell injury through modulation of autophagy. Cell Death Dis. 2015;6(9):e1885.View ArticleGoogle Scholar
  24. Jung HS, Chung KW, Kim JW, Kim J, Komatsu M, Tanaka K, Nguyen YH, Kang TM, Yoon K-H, Kim J-W. Loss of autophagy diminishes pancreatic β cell mass and function with resultant hyperglycemia. Cell Metab. 2008;8(4):318–24.View ArticleGoogle Scholar
  25. Hematti P, Kim J, Stein AP, Kaufman D. Potential role of mesenchymal stromal cells in pancreatic islet transplantation. Transplant Rev. 2013;27(1):21–9.View ArticleGoogle Scholar
  26. Bachar-Wikstrom E, Wikstrom JD, Ariav Y, Tirosh B, Kaiser N, Cerasi E, Leibowitz G. Stimulation of autophagy improves endoplasmic reticulum stress–induced diabetes. Diabetes. 2013;62(4):1227–37.View ArticleGoogle Scholar
  27. Xie Z, Hao H, Tong C, Cheng Y, Liu J, Pang Y, Si Y, Guo Y, Zang L, Mu Y. Human umbilical cord-derived mesenchymal stem cells elicit macrophages into an anti-inflammatory phenotype to alleviate insulin resistance in type 2 diabetic rats. Stem Cells. 2016;34(3):627–39.View ArticleGoogle Scholar
  28. Olefsky JM, Glass CK. Macrophages, inflammation, and insulin resistance. Annu Rev Physiol. 2010;72:219–46.View ArticleGoogle Scholar
  29. Fujisaka S, Usui I, Bukhari A, Ikutani M, Oya T, Kanatani Y, Tsuneyama K, Nagai Y, Takatsu K, Urakaze M. Regulatory mechanisms for adipose tissue M1 and M2 macrophages in diet-induced obese mice. Diabetes. 2009;58(11):2574–82.View ArticleGoogle Scholar
  30. Ruan H, Hacohen N, Golub TR, Van Parijs L, Lodish HF. Tumor necrosis factor-α suppresses adipocyte-specific genes and activates expression of preadipocyte genes in 3T3-L1 adipocytes: nuclear factor-κB activation by TNF-α is obligatory. Diabetes. 2002;51(5):1319–36.View ArticleGoogle Scholar
  31. Jager J, Grémeaux T, Cormont M, Le Marchand-Brustel Y, Tanti J-F. Interleukin-1β-induced insulin resistance in adipocytes through down-regulation of insulin receptor substrate-1 expression. Endocrinology. 2007;148(1):241–51.View ArticleGoogle Scholar
  32. Rotter V, Nagaev I, Smith U. Interleukin-6 (IL-6) induces insulin resistance in 3T3-L1 adipocytes and is, like IL-8 and tumor necrosis factor-α, overexpressed in human fat cells from insulin-resistant subjects. J Biol Chem. 2003;278(46):45777–84.View ArticleGoogle Scholar
  33. Nguyen MA, Satoh H, Favelyukis S, Babendure JL, Imamura T, Sbodio JI, Zalevsky J, Dahiyat BI, Chi N-W, Olefsky JM. JNK and tumor necrosis factor-α mediate free fatty acid-induced insulin resistance in 3T3-L1 adipocytes. J Biol Chem. 2005;280(42):35361–71.View ArticleGoogle Scholar
  34. Sakoda H, Ogihara T, Anai M, Funaki M, Inukai K, Katagiri H, Fukushima Y, Onishi Y, Ono H, Fujishiro M. Dexamethasone-induced insulin resistance in 3T3-L1 adipocytes is due to inhibition of glucose transport rather than insulin signal transduction. Diabetes. 2000;49(10):1700–8.View ArticleGoogle Scholar
  35. Thomson MJ, Williams MG, Frost SC. Development of insulin resistance in 3T3-L1 adipocytes. J Biol Chem. 1997;272(12):7759–64.View ArticleGoogle Scholar
  36. Lo K, Labadorf A, Kennedy NJ, Han M, Yap Y, Matthews B, Xin X, Sun L, Davis RJ, Lodish HF, et al. Analysis of in vitro insulin-resistance models and their physiological relevance to InVivo diet-induced adipose insulin resistance. Cell Rep. 2013;5(1):259–70.View ArticleGoogle Scholar
  37. Stephens JM, Lee J, Pilch PF. Tumor necrosis factor-α-induced insulin resistance in 3T3-L1 adipocytes is accompanied by a loss of insulin receptor substrate-1 and GLUT4 expression without a loss of insulin receptor-mediated signal transduction. J Biol Chem. 1997;272(2):971–6.View ArticleGoogle Scholar
  38. Yi P, Lu F-E, Xu L-J, Chen G, Dong H, Wang K-F. Berberine reverses free-fatty-acid-induced insulin resistance in 3T3-L1 adipocytes through targeting IKKβ. World J Gastroenterol. 2008;14(6):876.View ArticleGoogle Scholar
  39. Gual P, Le Marchand-Brustel Y, Tanti J-F. Positive and negative regulation of insulin signaling through IRS-1 phosphorylation. Biochimie. 2005;87(1):99–109.View ArticleGoogle Scholar
  40. Im SS, Kwon SK, Kim TH, Hi K, Ahn YH. Regulation of glucose transporter type 4 isoform gene expression in muscle and adipocytes. IUBMB Life. 2007;59(3):134–45.View ArticleGoogle Scholar
  41. Pessin JE, Saltiel AR. Signaling pathways in insulin action: molecular targets of insulin resistance. J Clin Investig. 2000;106(2):165.View ArticleGoogle Scholar
  42. Chandra V, Phadnis S, Nair PD, Bhonde RR. Generation of pancreatic hormone-expressing islet-like cell aggregates from murine adipose tissue-derived stem cells. Stem Cells. 2009;27(8):1941–53.View ArticleGoogle Scholar
  43. Wu X-H, Liu C-P, Xu K-F, Mao X-D, Zhu J, Jiang J-J, Cui D, Zhang M, Xu Y, Liu C. Reversal of hyperglycemia in diabetic rats by portal vein transplantation of islet-like cells generated from bone marrow mesenchymal stem cells. World J Gastroenterol. 2007;13(24):3342.View ArticleGoogle Scholar
  44. Choi J, Uchino H, Azuma K, Iwashita N, Tanaka Y, Mochizuki H, Migita M, Shimada T, Kawamori R, Watada H. Little evidence of transdifferentiation of bone marrow-derived cells into pancreatic beta cells. Diabetologia. 2003;46(10):1366–74.View ArticleGoogle Scholar
  45. Lechner A, Yang Y-G, Blacken RA, Wang L, Nolan AL, Habener JF. No evidence for significant transdifferentiation of bone marrow into pancreatic β-cells in vivo. Diabetes. 2004;53(3):616–23.View ArticleGoogle Scholar
  46. Gao X, Song L, Shen K, Wang H, Qian M, Niu W, Qin X. Bone marrow mesenchymal stem cells promote the repair of islets from diabetic mice through paracrine actions. Mol Cell Endocrinol. 2014;388(1):41–50.View ArticleGoogle Scholar
  47. Shree N, Bhonde RR. Conditioned media from adipose tissue derived mesenchymal stem cells reverse insulin resistance in cellular models. J Cell Biochem. 2017;118(8):2037–43.View ArticleGoogle Scholar
  48. Beenken A, Mohammadi M. The FGF family: biology, pathophysiology and therapy. Nat Rev Drug Discov. 2009;8(3):235.View ArticleGoogle Scholar
  49. Jonker JW, Suh JM, Atkins AR, Ahmadian M, Li P, Whyte J, He M, Juguilon H, Yin YQ, Phillips CT, et al. A PPARγ-FGF1 axis is required for adaptive adipose remodelling and metabolic homeostasis. Nature. 2012;485(7398):391–4.View ArticleGoogle Scholar
  50. Wu L, Leijten J, van Blitterswijk CA, Karperien M. Fibroblast growth factor-1 is a mesenchymal stromal cell-secreted factor stimulating proliferation of osteoarthritic chondrocytes in co-culture. Stem Cells Dev. 2013;22(17):2356–67.View ArticleGoogle Scholar
  51. Kim H-W, Song W-J, Li Q, Han S-M, Jeon K-O, Park S-C, Ryu M-O, Chae H-K, Kyeong K, Youn H-Y. Canine adipose tissue-derived mesenchymal stem cells ameliorate severe acute pancreatitis by regulating T cells in rats. J Vet Sci. 2016;17(4):539–48.View ArticleGoogle Scholar

Copyright

© The Author(s). 2018

Advertisement