- Research article
- Open Access
Canine distemper virus isolated from a monkey efficiently replicates on Vero cells expressing non-human primate SLAM receptors but not human SLAM receptor
- Na Feng†1, 2,
- Yuxiu Liu†3,
- Jianzhong Wang†1,
- Weiwei Xu2,
- Tiansong Li4,
- Tiecheng Wang2,
- Lei Wang6,
- Yicong Yu2,
- Hualei Wang2,
- Yongkun Zhao2,
- Songtao Yang2,
- Yuwei Gao2Email author,
- Guixue Hu1Email author and
- Xianzhu Xia1, 2, 5Email author
https://doi.org/10.1186/s12917-016-0757-x
© The Author(s). 2016
- Received: 12 August 2015
- Accepted: 23 June 2016
- Published: 2 August 2016
Abstract
Background
In 2008, an outbreak of canine distemper virus (CDV) infection in monkeys was reported in China. We isolated CDV strain (subsequently named Monkey-BJ01-DV) from lung tissue obtained from a rhesus monkey that died in this outbreak. We evaluated the ability of this virus on Vero cells expressing SLAM receptors from dog, monkey and human origin, and analyzed the H gene of Monkey-BJ01-DV with other strains.
Results
The Monkey-BJ01-DV isolate replicated to the highest titer on Vero cells expressing dog-origin SLAM (105.2±0.2 TCID50/ml) and monkey-origin SLAM (105.4±0.1 TCID50/ml), but achieved markedly lower titers on human-origin SLAM cells (103.3±0.3 TCID50/ml). Phylogenetic analysis of the full-length H gene showed that Monkey-BJ01-DV was highly related to other CDV strains obtained during recent CDV epidemics among species of the Canidae family in China, and these Monkey strains CDV (Monkey-BJ01-DV, CYN07-dV, Monkey-KM-01) possessed a number of amino acid specific substitutions (E276V, Q392R, D435Y and I542F) compared to the H protein of CDV epidemic in other animals at the same period.
Conclusions
Our results suggested that the monkey origin-CDV-H protein could possess specific substitutions to adapt to the new host. Monkey-BJ01-DV can efficiently use monkey- and dog-origin SLAM to infect and replicate in host cells, but further adaptation may be required for efficient replication in host cells expressing the human SLAM receptor.
Keywords
- Canine distemper virus (CDV)
- Monkey
- SLAM
- H protein
Background
Canine distemper virus (CDV) is a single-stranded, negative-sense, nonsegmented RNA virus of genus Morbillivirus within the family Paramyxoviridae. CDV is a highly contagious pathogen that can cause disease with high morbidity and mortality in immunologically naive hosts as a result of viral tropism for the cutaneous, respiratory, gastrointestinal, and central and peripheral nervous systems [1]. CDV has a broad host range and primarily affects animals belonging to the Canidae (e.g. dogs, wolves, and foxes) and Mustelidae (e.g. ferrets, badgers, and mink) families [2–4]. Previous studies had implicated CDV in the pathogenesis of Paget’s disease [5], and natural CDV infection of non-human primates has been reported [6–8]. In 2006, a CDV outbreak occurred in rhesus monkeys (Macaca mulatta) at a breeding farm in Guangxi province, China, with a morbidity rate (60 %) and a mortality rate (≈30 %), unexpectedly [6]. Two additional CD occurred in monkeys were reported in 2008. One occurred in rhesus monkeys at a laboratory animal center in Beijing with a reported 60 % (12/20) mortality [7], another occurred in Japan following the importation of cynomolgus monkeys (Macaca fascicularis) from China and was associated with a 10.6 % (46/432) mortality [8].
Host cell infection initiates with viral binding to receptor proteins on the surface of cells. The CDV viral envelope contains two integral glycoproteins, the hemagglutinin (H) protein and fusion (F) protein. The H protein mediates the binding of the virus to the cell membrane, and the F protein serves to fuse viral and host membranes, thereby enabling release of the viral contents into the cytoplasm [2]. The CDV-H glycoprotein mediates viral attachment through specific interactions with signaling lymphocyte activation molecule (SLAM) [9] or nectin-4 cellular receptors [10, 11]. SLAM is expressed on a subset of immune cells, while nectin-4 is expressed on epithelial cells of various organs. Although SLAM is a main receptor for morbilliviruses, each morbillivirus preferentially uses the SLAM of its host animals, as the specific residues within SLAM responsible for mediating interactions with the CDV-H protein can vary by species [12]. The specificity of the CDV-H protein for the SLAM receptor imposes species barriers and is partly responsible for restricting CDV host range [12, 13]. Nectin-4 is highly conserved among different animals [10]. Unlike the SLAM receptor, the characteristics of binding between nectin-4 and CDV were unknown. In this study, we evaluated the replication capacity of a CDV isolate obtained from a naturally infected monkey on Vero cells expressing dog, monkey, or human SLAM receptor proteins to better understand how CDV-H protein receptor specificity affects host range restriction.
Results
Surface expression of dog, monkey, and human SLAM on Vero cells
Stable expression of dog, monkey and human SLAM protein on Vero cells. Vero cells were transfected with expression plasmids to mediate expression of HA epitope-tagged SLAM proteins from dog, monkey, and human and selected with G418. The control Vero cells were transfected by empty vector. The resulting cell lines were named Vero/DogSLAM,Vero/MonkeySLAM and Vero/HumanSLAM. Anti-influenza virus HA epitope MAb was used to confirm surface expression of each version of the SLAM protein by flow cytometry
Isolation of CDV from the lung tissue of a deceased rhesus monkey
Infection of Vero cells expressing dog SLAM protein with CDV from a deceased rhesus monkey. Microscopic evaluation of Vero/DogSLAM cells (a) and Vero cells (b) following inoculation with Monkey-BJ01-DV at a MOI of 0.01. Inoculation of Vero/DogSLAM cells resulted in obvious CPE. Detection of CDV antigens in Vero cells expressing the dog SLAM protein (c) and untransfected Vero cells (d) 64 h following inoculation with Monkey-BJ01-CDV at a MOI of 0.01. Cells were fixed and probed with a mouse monoclonal anti-CDV nucleoprotein antibody. A FITC-conjugated goat anti-mouse secondary antibody was used for detection
Phylogenetic analysis of the H protein of Monkey-BJ01-DV
Amino acid differences between the hemagglutinin of Monkey-BJ01-DV and other CDV isolates
Amino acid sequence identitya | Sequence no. | 24 | 276 | 365 | 392 | 435 | 530 | 542 | 549 | 597 |
|---|---|---|---|---|---|---|---|---|---|---|
98.4 % | JN896331 (PS-dog) | S | E | V | Q | D | G | I | Y | R |
97.5 % | AB286946 (MD231-dog) | b | b | A | b | b | b | b | b | b |
98.4 % | JQ732173 (LDH (06)-fox) | b | b | b | b | b | b | b | b | b |
98.4 % | FJ848530 (BJ080514-dog) | b | b | b | b | b | b | b | b | b |
98.2 % | EU325720 (fox-Hebei07) | b | b | b | b | b | b | b | b | b |
98.0 % | EU325721 (fox-HLJ07) | b | b | b | b | b | b | b | b | b |
97.4 % | EU325724 (mink-LN) | b | b | b | b | b | b | b | b | b |
97.9 % | EU325728 (raccoon-JL07) | b | b | b | b | b | b | b | b | b |
97.5 % | GQ332530 (dog-Wuhan) | b | b | b | b | b | b | b | b | b |
97.3 % | CDV-TM-CC | b | b | b | b | b | b | b | b | b |
----- | Monkey-BJ01-DV | F | V | A | R | Y | b | F | b | H |
99.8 % | FJ405223 (monkey-BJ-01) | F | V | A | R | Y | b | F | b | b |
99.8 % | AB687720 (mCNY07-dV) | F | V | A | R | Y | b | F | b | H |
99.0 % | FJ405224 (monkey-KM-01) | b | V | A | R | Y | b | F | b | b |
Replication of Monkey-BJ01-DV on Vero cells expressing SLAM from dog-, monkey-, or human- origin
Replication of Monkey-BJ01-DV and CDV-TM-CC in Vero/SLAM cells. Cells were infected at a MOI of 0.01. Viral titers were measured 48 h post-infection
Discussion
Morbilliviruses, including measles virus (MV), CDV, and rinderpest virus (RPV), are thought to have originated from a common ancestor several thousand years ago [14]. In general, however, each virus is able to naturally infect a relatively restricted number of host species. MV infection is limited to primates, CDV infection is limited to members of the Canidae, Mustelidae and Procyonidae families, and RPV infection is limited to ruminants [15]. Experimentally, monkeys are susceptible to MV infection and dogs to CDV infection [16]. Despite the apparent host range restriction of morbilliviruses, CDV has crossed species barriers, suggesting a potential ongoing expansion of host range. The first report of natural CDV infection of non-human primates was reported in 1989 among Japanese monkeys [15]. In 2006, a CDV epidemic affected a rhesus monkey (Macaca mulatta) breeding farm in China, inflicting high morbidity (60 %) and mortality (≈30 %) in young monkeys [6]. In 2008, Japan imported 432 cynomolgus monkeys (Macaca fascicularis) from China and 46 died from CDV while held in quarantine [8]. We isolated CDV from a deceased rhesus monkey (Monkey-BJ01-DV) following a 2008 outbreak in Beijing in which 12 of 20 rhesus monkeys died from CDV [7]. Collectively, these reports suggest significant changes in the epidemiology of CDV caused by an expanding CDV host range and/or viral virulence.
The complete genomes of three monkey-origin CDV isolates associated with outbreaks in China have been reported (Monkey-BJ01-DV (KF856711), CYN07-dV (AB687720) and MKY-KM-08 (HM852904) and are highly related to other epidemic CDV strains affecting species of the Canidae and Mustelidae families in China [6, 8] (Table 1). The H protein mediates viral attachment by binding to one or more cellular receptors [9, 11]. Several studies have speculated about the impact of specific amino acid substitutions within the H protein on interactions with the SLAM receptor. In vitro receptor-binding studies showed that amino acid residues 527, 528, 529, and 552 of the H protein are conserved among all morbilliviruses and are crucial for CDV-H to SLAM dependent fusion [4]. In particular, residues 530 and 549 both fall into receptor-binding domains located on propeller β-sheet 5 of the H protein [17]. Sequence analysis of the H gene of all three monkey CDV strains revealed a glycine (G) and a tyrosine (Y) at amino acid positions 530 and 549 of the partial SLAM-receptor binding region. G530 and Y549 are typically found in viral strains obtained from dogs in China, whereas other amino acid residues are present in CDV isolates obtained from wildlife [18, 19]. This suggests that the CDV isolated from monkeys was transmitted from domestic dogs rather than from other wildlife. In this study, we found that amino acid Y549 was conserved within CDV lineages of the isolates analyzed, regardless of host species. CDV transmission in wild carnivore and non-canid species may most often occur between individuals within a species, and may also be influenced by a range of additional factors such as population size and ranging patterns. The three monkey CDV strains possessed E276V, Q392R, D435Y and I542F substitutions, which are unique changes when compared to the other Asia type I lineage strains. In particularly, the I542F substitution falls with the SLAM-binding regions of the H protein. The H protein amino acid substitutions identified among monkey CDV isolates may help explain recent changes in CDV host range.
The Monkey-BJ01-DV can efficiently grow on the Vero cells expressing SLAM from dog- and monkey-origin, but not the cells expressing SLAM receptor of human- origin. Interestingly, while the amino acid sequence identity of dog and monkey SLAM is only 63.6 %, the Monkey-BJ01-DV strain can replicate on the Vero cells expressing SLAM receptor of dog-origin as efficiently as the Vero cells expressing monkey-origin SLAM. Factors other than the receptor binding, such as intracellular replication of the viruses may also be important for the establishment of infection. Further studies are required to understand the mechanisms by which CDV can cross species barriers.
Conclusions
Canine distemper virus isolated from a deceased rhesus monkey efficiently replicates on the Vero cells expressing non-human primate SLAM receptors but not human SLAM receptor. The monkey origin-CDV-H protein could possess specific substitutions to adapt to the new host.
Methods
Plasmids and cell lines
Peripheral blood samples from a dog and rhesus monkey were collected from the Animal Hospital of Jilin University and the Animal Laboratory Center of the Academy of Military Medical Sciences, respectively. Human peripheral blood was kindly provided by the voluntary enrolled in this study. Peripheral blood mononuclear cells (PBMCs) of the dog, rhesus monkey and human were isolated from peripheral blood using dog and human lymphocyte separation media (TBD, Tianjin, China) according to the manufacturer protocols, respectively. Total RNA was extracted from the dog, rhesus monkey and human PBMCs after 2–4 h of stimulation with 2.5-3.0 mg of phytohemagglutinin (PHA) per milliliter and was used for reverse transcription with oligo (dT) primers. The presence and location of signal peptide cleavage sites in the amino acid sequences from the dog-SLAM (AF325357), rhesus monkey-SLAM (XM-001117605) and human-SLAM (NM-003037) were predicted by the Signal P 3.0 software. The SLAM gene of the dog, rhesus monkey and human without the signal peptide were encoded using various combinations of the primers designed on the basis of known SLAM sequences. The primer sets used were as follows: dogSLAM-F: 5′-GCCTCGAGACAGGTGAGAGCTTGATGAAT-3′ with the XhoI site underlined and dogSLAM-R: 5′-G CAGATCTTCAGCTCTCTGGGAACGTCAC-3′ with the BglII site underlined for dog; monkey/humanSLAM-F: 5′-GCCTCGAGGCAAGCTATGGAACAGGTGGG-3′; monkeySLAM-R: 5′-GCAGATCTTCAGCTCTCTGGAAGTGTCACACT-3′; and humanSLAM-R: 5′-TCAGATCTCTGGRARYGTCACRCT-3′), respectively. After checking against the NCBI reference sequence of dog SLAM, rhesus monkey SLAM and human SLAM, the cDNA encoding the DogSLAM, MonkeySLAM, and HumanSLAM proteins were inserted into the pCAGGS (Neo) vector possessing the immunoglobulin Igk leader sequence (GAG ACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGTGAC) and the influenza virus hemagglutinin (HA) epitope (TATCCATATGATGTTCCAGATTATGCT) [20], generated pCAGDogSLAM, pCAGMonkeySLAM and pCAGHumanSLAM. Vero cells constitutively expressing dog SLAM (Vero/DogSLAM), rhesus monkey SLAM (Vero/MonkeySLAM) and human SLAM (Vero/HumanSLAM) were generated by transfecting Vero cells with pCAGDogSLAM, pCAGMonkeySLAM or pCAGHumanSLAM, respectively, and control Vero cells were transfected by empty vector. These cells were maintained in DMEM with 5 % FBS and 0.8 mg/ml Geneticin (G418; Invitrogen) in a humidified atmosphere at 37 °C and 5 % CO2. The above -described cells were stained with anti-influenza virus HA epitope MAb 12CA5 (Boehringer Mannheim), and then stained with fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse IgG (Abcam, Cambridge science Park, UK). These stained cells were analyzed on a FACScan machine (Becton Dickinson) [2].
Virus isolation
Tissue samples used for virus isolation were obtained from the lungs of a deceased rhesus monkey during the CDV epizootic in Beijing in 2008 [7]. Lung tissue was suspended in cold phosphate- buffered saline (PBS) with antibiotics and was grinded into a homogenate. Homogenized lung samples were centrifuged at 2500 rpm for 5 min; the supernatant was collected and centrifuged an additional 5 min at 5000 rpm. Supernatants were inoculated onto monolayers of Vero/DogSLAM cells, from which a CDV isolate was subsequently obtained and named Monkey-BJ01-DV. An additional CDV-TM-CC strain was isolated from a Tibetan mastiff in our laboratory [21]. Normal Vero cells and Vero/DogSLAM cells were plated in 24-well plates and infected with the Monkey-BJ01-DV. Productive CDV infection from the cultured cells was analyzed with a mouse monoclonal anti-CDV nucleoprotein antibody. A FITC-conjugated goat anti-mouse IgG was used as the secondary antibody, cells were analyzed with a fluorescence microscope (BX51FL; Olympus, Japan).
RT-PCR and sequencing analysis of the Monkey-BJ01/Monkey-BJ01-DV
Total RNA was extracted from the lung of died monkey/Monkey-BJ01-DV by using TRIzol reagent (Molecular Research Center Inc., USA) according to the manufacturer instructions. Reverse transcription (RT) was carried out using the Superscript II reverse transcriptase (Invitrogen, USA) according to the standard protocol. The CDV-H gene was cloned using the Ex-Taq DNA polymerase (TaKaRa) with the following primers: CDV-HF: GCGAATTCATGCTCTCCTACCAAGACAAGGTG with the EcoRI site underlined and according to the CDV-HR: GGCCCTCGAGTCAAGGTTTTGAACGATTAC with XhoI site underlined. The PCR products were cloned into a pMD 18-T vector (TaKaRa) and were sequenced. At least five clones of each PCR products were analyzed to acquirie the accurate sequence. The sequence determined in this study had been registered at the GenBank under accession numbers FJ405223 and KM923900.
Replication of CDV on Vero cells expressing the SLAM receptor from various animal species
Vero/DogSLAM, Vero/MonkeySLAM, and Vero/HumanSLAM cells and Vero cells (empty vector transfected cells) (1.8 × 105 cells/well) were cultured in 24-well plates and infected with Monkey-BJ01-DV or CDV-TM-CC at a multiplicity of infection (MOI) of 0.01. The cells and supernatants were harvested 48 h post-infection and were stored at −80 °C until the virus titers were measured using the Vero/DogSLAM cells by the limiting dilution method and expressed as TCID50. Three independent experiments were performed to evaluate the CDV replication on the SLAM-expressing Vero cells.
Abbreviations
CDV, canine distemper virus; CPE, cytopathic effect; F, fusion; FITC, fluorescein isothiocyanate; G, glycine; H, hemagglutinin; IFA, immunofluorescence staining; MOI, multiplicity of infection; MV, measles virus; PBMCs, peripheral blood mononuclear cells; PBS, phosphate-buffered saline; PHA, phytohemagglutinin; RPV, rinderpest virus; RT, reverse transcription; SLAM, signaling lymphocyte activation molecule; Y, tyrosine
Declarations
Acknowledgements
We thank Animal Hospital of Jilin University, Animal Laboratory Center of the Academy of Military Medical Sciences and the voluntary enrolled in this study for providing the peripheral bloods specimens. We also thank the Peter Wilker for editing the manuscript.
Funding
This work was supported by Chinese Special Fund for Agro-scientific Research in the Public Interest (201303042).
Availability of data and materials
Sequence data are deposited under GenBank accession numbers FJ405223 and KM923900.
Authors’ contributions
YG and XX designed and oversaw the experiments. NF, YL and JW wrote the manuscript. NF, TL, LW, XW and YY carried out the laboratory experiments. TW, YL, HW and YZ analysed the data, interpreted the results. YG, SY and GH were involved in experimental design and manuscript revision. All authors have read and approved the submitted manuscript.
Competing interests
The authors declare that they have no competing interests.
Consent for publication
Not applicable.
Ethics approval and consent to participate
The protocol of the study was carried out in accordance with guidelines of animal welfare of World Organization for Animal Health. All experimental protocols were approved by the supervisory committee of science and technology of the Academy of Military Medical Sciences.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
Authors’ Affiliations
References
- Osterhaus AD, de Swart RL, Vos HW, Ross PS, Kenter MJ, Barrett T. Morbillivirus infections of aquatic mammals: newly identified members of the genus. Vet Microbiol. 1995;44(2–4):219–27.View ArticlePubMedGoogle Scholar
- von Messling V, Zimmer G, Herrler G, Haas L, Cattaneo R. The hemagglutinin of canine distemper virus determines tropism and cytopathogenicity. J Virol. 2001;75(14):6418–27.View ArticleGoogle Scholar
- Pomeroy LW, Bjornstad ON, Holmes EC. The evolutionary and epidemiological dynamics of the paramyxoviridae. J Mol Evol. 2008;66(2):98–106.View ArticlePubMedPubMed CentralGoogle Scholar
- von Messling V, Oezguen N, Zheng Q, Vongpunsawad S, Braun W, Cattaneo R. Nearby clusters of hemagglutinin residues sustain SLAM-dependent canine distemper virus entry in peripheral blood mononuclear cells. J Virol. 2005;79(9):5857–62.View ArticleGoogle Scholar
- Mee AP, Sharpe PT. Dogs, distemper and Paget’s disease. BioEssays. 1993;15(12):783–9.View ArticlePubMedGoogle Scholar
- Qiu W, Zheng Y, Zhang S, Fan Q, Liu H, Zhang F, Wang W, Liao G, Hu R. Canine distemper outbreak in rhesus monkeys, China. Emerg Infect Dis. 2011;17(8):1541–3.Google Scholar
- Sun Z, Li A, Ye H, Shi Y, Hu Z, Zeng L. Natural infection with canine distemper virus in hand-feeding Rhesus monkeys in China. Vet Microbiol. 2010;141(3–4):374–8.View ArticlePubMedGoogle Scholar
- Sakai K, Nagata N, Ami Y, Seki F, Suzaki Y, Iwata-Yoshikawa N, Suzuki T, Fukushi S, Mizutani T, Yoshikawa T et al. Lethal canine distemper virus outbreak in cynomolgus monkeys in Japan in 2008. J Virol. 2013;87(2):1105–14.Google Scholar
- Seki F, Ono N, Yamaguchi R, Yanagi Y. Efficient isolation of wild strains of canine distemper virus in Vero cells expressing canine SLAM (CD150) and their adaptability to marmoset B95a cells. J Virol. 2003;77(18):9943–50.View ArticlePubMedPubMed CentralGoogle Scholar
- Noyce RS, Delpeut S, Richardson CD. Dog nectin-4 is an epithelial cell receptor for canine distemper virus that facilitates virus entry and syncytia formation. Virology. 2013;436(1):210–20.View ArticlePubMedGoogle Scholar
- Pratakpiriya W, Seki F, Otsuki N, Sakai K, Fukuhara H, Katamoto H, Hirai T, Maenaka K, Techangamsuwan S, Lan NT et al. Nectin4 is an epithelial cell receptor for canine distemper virus and involved in neurovirulence. J Virol. 2012;86(18):10207–10.View ArticlePubMedPubMed CentralGoogle Scholar
- Ohishi K, Ando A, Suzuki R, Takishita K, Kawato M, Katsumata E, Ohtsu D, Okutsu K, Tokutake K, Miyahara H et al. Host-virus specificity of morbilliviruses predicted by structural modeling of the marine mammal SLAM, a receptor. Comp Immunol Microbiol Infect Dis. 2010;33(3):227–41.Google Scholar
- Nikolin VM, Osterrieder K, von Messling V, Hofer H, Anderson D, Dubovi E, Brunner E, East ML. Antagonistic pleiotropy and fitness trade-offs reveal specialist and generalist traits in strains of canine distemper virus. PLoS One. 2012;7(12), e50955.Google Scholar
- Norrby E, Sheshberadaran H, McCullough KC, Carpenter WC, Orvell C. Is rinderpest virus the archevirus of the Morbillivirus genus? Intervirology. 1985;23(4):228–32.View ArticlePubMedGoogle Scholar
- Yoshikawa Y, Ochikubo F, Matsubara Y, Tsuruoka H, Ishii M, Shirota K, Nomura Y, Sugiyama M, Yamanouchi K. Natural infection with canine distemper virus in a Japanese monkey (Macaca fuscata). Vet Microbiol. 1989;20(3):193–205.Google Scholar
- DeLay PD, Stone SS, Karzon DT, Katz S, Enders J. Clinical and immune response of alien hosts to inoculation with measles, rinderpest, and canine distemper viruses. Am J Vet Res. 1965;26(115):1359–73.PubMedGoogle Scholar
- McCarthy AJ, Shaw MA, Goodman SJ. Pathogen evolution and disease emergence in carnivores. Proc Biol Sci. 2007;274(1629):3165–74.View ArticlePubMedPubMed CentralGoogle Scholar
- Muller A, Silva E, Santos N, Thompson G. Domestic dog origin of canine distemper virus in free-ranging wolves in Portugal as revealed by hemagglutinin gene characterization. J Wildl Dis. 2011;47(3):725–9.View ArticlePubMedGoogle Scholar
- Sekulin K, Hafner-Marx A, Kolodziejek J, Janik D, Schmidt P, Nowotny N. Emergence of canine distemper in Bavarian wildlife associated with a specific amino acid exchange in the haemagglutinin protein. Vet J (London, England : 1997). 2011;187(3):399–401.View ArticleGoogle Scholar
- Hara Y, Suzuki J, Noguchi K, Terada Y, Shimoda H, Mizuno T, Maeda K. Function of Feline Signaling Lymphocyte Activation Molecule as a Receptor of Canine Distemper Virus. J Vet Med Sci. 2013;75(8):1085–9.Google Scholar
- Li W, Li T, Liu Y, Gao Y, Yang S, Feng N, Sun H, Wang S, Wang L, Bu Z et al. Genetic characterization of an isolate of canine distemper virus from a Tibetan Mastiff in China. Virus Genes. 2014;49(1):45–57.Google Scholar
