Open Access

Phenotypic and genetic characterization of Piscirickettsia salmonis from Chilean and Canadian salmonids

  • Alexander Otterlei1,
  • Øyvind J. Brevik2,
  • Daniel Jensen1,
  • Henrik Duesund2,
  • Ingunn Sommerset3,
  • Petter Frost3,
  • Julio Mendoza4,
  • Peter McKenzie5,
  • Are Nylund1 and
  • Patricia Apablaza2Email author
BMC Veterinary ResearchBMC series – open, inclusive and trusted201612:55

https://doi.org/10.1186/s12917-016-0681-0

Received: 26 November 2015

Accepted: 9 March 2016

Published: 15 March 2016

Abstract

Background

The study presents the phenotypic and genetic characterization of selected P. salmonis isolates from Atlantic salmon and rainbow trout suffering from SRS (salmonid rickettsial septicemia) in Chile and in Canada. The phenotypic characterization of the P. salmonis isolates were based on growth on different agar media (including a newly developed medium), different growth temperatures, antibiotics susceptibility and biochemical tests.

Results

This is the first study differentiating Chilean P. salmonis isolates into two separate genetic groups. Genotyping, based on 16S rRNA-ITS and concatenated housekeeping genes grouped the selected isolates into two clades, constituted by the Chilean strains, while the Canadian isolates form a branch in the phylogenetic tree. The latter consisted of two isolates that were different in both genetic and phenotypic characteristics. The phylogenies and the MLST do not reflect the origin of the isolates with respect to host species. The isolates included were heterogeneous in phenotypic tests.

Conclusions

The genotyping methods developed in this study provided a tool for separation of P. salmonis isolates into distinct clades. The SRS outbreaks in Chile are caused by minimum two different genetic groups of P. salmonis. This heterogeneity should be considered in future development of vaccines against this bacterium in Chile. Two different strains of P. salmonis, in regards to genetic and phenotypic characteristics, can occur in the same contemporary outbreak of SRS.

Keywords

P. salmonis Phenotyping Genotyping 16S rDNA-ITS Housekeeping genes Phylogeny MLST

Background

The Chilean aquaculture industry has constantly faced problems with Piscirickettsia salmonis, which causes salmonid rickettsial septicemia (SRS) [1]. This disease causes high mortalities in several salmonids species Atlantic salmon (Salmo salar), Rainbow trout (Onchorhyncus mykiss), Coho salmon (Onchorhyncus kisutch), and was responsible for 90 % of the total use of antibiotics in Chile in 2014 [2]. P. salmonis has been detected in several countries including Norway, Canada, Scotland, Ireland and Chile [3, 4], but opposed to the situation in Chile, SRS is considered manageable in these countries.

The present knowledge on P. salmonis is restricted in several aspects such as characterization (phenotypical and genetic), geographical distribution, host specificity, presence of natural reservoirs and transmission routes. Although several vaccines are available [57] none of them are able to induce complete protection against SRS. This lack of protection suggests that more basic knowledge is needed about the biology of P. salmonis.

P. salmonis is a Gram-negative, predominantly coccoid, aerobic, non-encapsulated, and highly fastidious bacterium of approx. 0.5–1.5 μm diameter [3]. The pathogen was first described as an obligatory intracellular bacterium and has traditionally been cultured on Chinook salmon embryos cells (CHSE-214) and others fish cell lines [8]. In 2008 it was shown that P. salmonis could be grown on artificial cell-free media [911]. However, work at our laboratory has shown that not all isolates growth well at these media, hence, we developed a new improved medium for isolation and culturing of P. salmonis strains.

This study present new basic knowledge of P. salmonis isolated from sub-acute, acute and chronic outbreaks of SRS. These isolates are compared to the type strain, LF-89. The new knowledge presented could form a better basis for development of efficient strategies for control and treatment of SRS, and possibly a new basis for future development of vaccines against P. salmonis.

Methods

Collection of P. salmonis

The isolates of P. salmonis were obtained in 2011 and 2012 from Atlantic salmon and Rainbow trout suspected or diagnosed with SRS. The Chilean isolates, were obtained from a pool of homogenized fish tissues (kidney, spleen, liver, brain). The Canadian isolates were collected from the same site during a single outbreak of SRS, and from kidney. All the isolates were sent to the Fish Diseases Research Group at the University of Bergen where they were sub-cultured on CHAB agar [10] and stored at −80 °C for later characterization. An overview of all the isolates included in the study is presented in the Table 1. The geographical origins of the isolates are presented in Fig. 1. The P. salmonis type isolate (LF-89) was also included in the study.
Table 1

Data for all the selected P. salmonis isolates included in the study

Isolate code

Country

County (Region)

Sampling date

Mortality (%)

Host

Sample tissue

Clinical condition

LF-89

Chile

Puerto Montt (X)

1989

na

Coho salmon

kidney

na

Ch2-As-I

Chile

Chiloé Sur (X)

08.08.2012

7,8

Atlantic salmon

k-l-sp-b

acute

Ch3-Rt-L

Chile

Calbuco (X)

03.10.2012

6,7

Rainbow trout

lession

sub-acute

Ch4-Rt-L

Chile

Calbuco (X)

05.10.2012

6,7

Rainbow trout

lession

sub-acute

Ch5-As-I

Chile

Chiloé Centro (X)

18.07.2012

5,1

Atlantic salmon

k-l-b

sub-acute

Ch6-Rt-L

Chile

Calbuco (X)

10.08.2012

13,2

Rainbow trout

lession

sub-acute

Ch7-As-L

Chile

Aysén (XI)

na

na

Atlantic salmon

muscle

chronic

Ch8-Rt-K

Chile

Chiloé Centro (X)

17.06.2011

1,9

Rainbow trout

kidney

sub-acute

Ch9-As-na

Chile

Chiloé Centro (X)

27.03.2012

2,4

Atlantic salmon

na

sub-acute

Ch10-As-I

Chile

Chiloé Sur (X)

24.07.2012

21,5

Atlantic salmon

k-l-sp-b

acute

Ch11-As-I

Chile

Chiloé Centro (X)

04.05.2012

2,2

Atlantic salmon

k-l-b

sub-acute

Ch12-As-I

Chile

Chiloé Centro (X)

07.05.2012

14,8

Atlantic salmon

k-l-b

acute

Ch13-As-I

Chile

Chiloé Centro (X)

18.04.2012

3,6

Atlantic salmon

k-l-sp-b

chronic

Ch14-As-I

Chile

Chiloé Centro (X)

13.01.2012

14,8

Atlantic salmon

k-sp

acute

Ch15-As-I

Chile

Chiloé Centro (X)

23.08.2012

5,4

Atlantic salmon

k-l-b-sp

sub-acute

Ch16-As-I

Chile

Chiloé Centro (X)

June 2012

14,8

Atlantic salmon

k-l-b

acute

Ch17-As-I

Chile

Chiloé Centro (X)

23.05.2012

14,8

Atlantic salmon

k-l-b

acute

Ch18-As-I

Chile

Chiloé Centro (X)

22.06.2012

3,6

Atlantic salmon

k-l-b-sp

chronic

Ca19-As-I

Canada

British Columbia

11.12.2012

<0,03

Atlantic salmon

kidney

chronic

Ca20-As-I

Canada

British Columbia

11.12.2012

<0,03

Atlantic salmon

kidney

chronic

Codes indicates the country of isolation, Chile (Ch), Canada (Ca); number of isolate (1–20); fish species, Atlantic salmon (As), Rainbow trout (Rt), Coho salmon (Cs); and tissue, kidney (K), liver (l), spleen (sp) and brain (b). The samples were obtained from a pool of internal organs. The codes are: I from internal lesions, L from external lesions, and K from kidney. Sub-acute and acute clinical conditions frequently present hemorrhages in the brain, splenomegaly and extensive congestion particularly in the swimbladder. In chronic conditions typical findings are whitish nodules in the liver which becomes brownish and finally progress as granuloma. Mostly in Atlantic salmon and rainbow trout, the dermis present speckle erosions which progress to pustules and finally caverns. It has also seen splenomegaly and hepatomegaly; pericarditis with fibrin deposits in Atlantic salmon and rainbow trout. In Coho salmon the fibrin deposits are located mostly internally in the abdomen. Mortality percentage is described as percentage of dead fish due to SRS, from necropsy findings, in one production cycle. In most of the farms antimicrobials were used for treatment. Na: information not available

Fig. 1

Geographical location of the Chilean farms from were P. salmonis isolates were obtained. The number correspond to isolates: 1 = LF-89, 2 = Ch2-As-I, 3 = Ch3-Rt-L, 4 = Ch4-Rt-L, 5 = Ch5-As-I, 6 = Ch6-Rt-L, 7 = Ch7-As-L, 8 = Ch8-Rt-K, 9 = Ch9-As-na, 10 = Ch10-As-I, 11 = Ch11-As-I, 12 = Ch12-As-I, 13 = Ch13-As-I, 14 = Ch14-As-I, 15 = Ch15-As-I, 16 = Ch16-As-I, 17 = Ch17-As-I, and 18 = Ch18-As-I

This study followed the recommendations of the Norwegian Animal Welfare Act (01.01.2010) and the work was done under the regulations given by the Norwegian Food Safety Authority. The bacterial samples were obtained from the fish after they has been anaesthetized by a blow to the head and killed by instantly decapitation. This procedure complies with the Norwegian fish welfare regulations.

New growth medium

To improve the growth of P. salmonis on solid media, a new optimized SRS blood agar (SRS-BA) was developed. The composition of this agar was 40 g of TSA (BD, Difco); 20 g of Red Sea Salt (RSS) (Red Sea, USA); 50 ml of defibrinated sheep blood (DSB) (Oxoid Limited, UK); 1 g of L-cysteine (Sigma-Aldrich); 5 g of D-glucose (Sigma-Aldrich); 50 ml of fetal bovine serum (FBS) (Thermo Scientific Hyclone, USA); 0.2 mM ferric nitrate (Sigma-Aldrich) and reverse osmosis water (RO) to a final volume of 1000 ml. RSS was chosen to simulate natural sea water composition. RO water, TSA and RSS were autoclaved at 121 °C for 15 min. DSB was added after cooling from autoclaving. Subsequently, the agar was cooled down to 50 °C and L-cysteine, D-glucose, FBS and ferric nitrate were added. The pH was adjusted to 6.8 ± 0.2.

Phenotypic characterization

Colonies > 1 mm were used for morphological characterization and bacteria from these colonies were Gram-stained for the description of cell morphology and other phenotypic characteristics.

Testing of different growth media was performed using two colonies from each isolate streaked on the following media: SRS-BA, Austral-TSHem [11], CHAB [10], CHAB with 0.2 mM Fe, blood agar (BA), BA with 2 % NaCl, marine agar (MA) and tryptone-yeast extract-salts with glucose agar (FLPA) [12] and incubated at 19 °C for 14 days. The temperature range for bacterial growth measured as number of colonies and colony size was tested using three colonies streaked out on SRS-BA and incubated at 8, 11, 16, 19, 22, and 25 °C. The growth was recorded at days 3, 7, 10 and 14 in both tests.

Test of the susceptibility to antimicrobial drugs was performed by the agar diffusion method using tablets as described by Justesen et al. [13], with some modifications. 19 °C was used for incubation, as this is within the common optimum temperature range of all isolates. The inhibition zone was measured after 10 days of incubation, to ensure sufficient growth. The antimicrobial sensitivity was tested for all the isolates against: streptomycin (10 μg); oxytetracycline (30 μg); penicillin (1 unit); ceftazidime (30 μg); ampicillin (2 μg); and florfenicol (30 μg). The inhibition zone was measured, in millimeters, from the tablet border towards to all the extension of the inhibition area.

Indole and oxidase tests were performed with BBL™ DrySlide™ (BD BBL™, U.S.A) kits. The cefinase test using BBL™ Cefinase™ Paper Disc (BD BBL™, U.S.A) was used to determine the production of β-lactamases. Catalase was detected by adding a drop of hydrogen peroxide 3 % (Sigma-Aldrich, Germany) to a microscope slide before transferring a small amount of bacteria onto the H2O2 solution. The API ZYM galleries (BioMérieux, U.S.A) for the detection of bacterial enzymes were used according to the manufacturer’s protocol, except that the incubation temperature was set at 19 °C and the incubation time at 24 h. A 6.0 McFarland standard, as recommended by BioMérieux, was made in advance for turbidity comparison. H2S production was done using hydrogen Sulfide Test Strips (Sigma-Aldrich, Switzerland). All the phenotypical and biochemical tests were performed in triplicate, with the exception of the antimicrobial susceptibility analysis, which was done in duplicate.

Genetic characterization

The DNA extraction from pure cultures of all P. salmonis was performed with an E.Z.N.A Tissue DNA kit. The quality of DNA was tested using NanoDrop (Saveen Werner, Life Science) before storing at −20 °C.

PCR, purification and visualization of products by gel electrophoresis, and sequencing were performed as described by Apablaza et al. [14]. Sequencing of the 20 isolates was performed using specific primers for 16S rDNA and ITS, and for the housekeeping genes, HK (dnaK, groEL, tbpB, mltB, ospA, radA, airA, bax, tnpA, elfP). The primers are presented in Table 2. The Vector NTI® v9.0 Software package (Invitrogen) was used for sequence assembling and alignment. Manual adjustments and verification of reading frames for the protein coding genes were conducted in GeneDoc (Karl Nicholas ©2000). The evolutionary analysis and calculation of the best fit model for the 16S rDNA-ITS dataset (2191 base pairs) was conducted in MEGA6 [15]. The maximum likelihood method using the Hasegawa-Kishino-Yano [16] model with discrete Gamma distribution was applied.
Table 2

Primers used for PCR analysis in the present study

Target gene

Primer

Direction

Sequence (5´–3´)

Reference

16 s rDNA

Eug B27F

Fwd

AGAGTTTGATCMTGGCTCAG

[25]

 

Eug A1518R

Rev

AAGGAGGTGATCCANCCRCA

[25]

ITS

SRS-ITS/F

Fwd

GTACACACCGCCCGTCACAC

Present study

 

SRS-ITS/R

Rev

CCTCACGGTACTAGTTCACTATCGG

Present study

dnaK

SRS-dnaK/F2

Fwd

CCGTGTCGTGTGGCGCTAAAA

Present study

 

SRS-dnaK/R2

Rev

TTGAGATTGAGCCTGCTCCGC

Present study

 

SRS-dnaK3/F1

Fwd

CCGCGTGTGATTGAGAGTGC

Present study

 

SRS-dnaK3/R1

Rev

CGTCATCACCCCACCCATGG

Present study

groEL

SRS-groEL/F1

Fwd

CTTCGGTACCGGTTCCCGTC

Present study

 

SRS-groEL/R1

Rev

TCTTGCAGTTTCTCGCGGTCG

Present study

 

SRS-groEL/F2

Fwd

GTGAAGCTCTGGCAACACTCGTC

Present study

 

SRS-groEL/R2

Rev

AGGAAGCTCTGCAACCATCGC

Present study

tbpB

SRS-tbpB/F1

Fwd

AACTGGGCAGGCGTCACTGTT

Present study

 

SRS-tbpB/R1

Rev

CGGCGCGTCTCTAATGTTCG

Present study

 

SRS-tbpB2/F2

Fwd

CCAAGCTGGATCACCGCCAT

Present study

 

SRS-tbpB2/R2

Rev

AAAGATAGGCCCAGCCACGC

Present study

mltB

SRS-mltB/F

Fwd

ACCACTCACGCGGCATCTAA

Present study

 

SRS-mltB/R

Rev

ACTCAAATCATACACCGCCATTGCA

Present study

ospA

SRS-ospA/F

Fwd

AGCCGTCAAGAAGTCGGAGCT

Present study

 

SRS-ospA/R

Rev

TGCCAACGACCATCCGCTTG

Present study

radA

SRS-radA/F1

Fwd

ATCAGTCGCCAGCCTGTTGG

Present study

 

SRS-radA/FR1

Rev

GTCCTCGTTGCACTGGACGA

Present study

airA

SRS-air/F1

Fwd

GGGTGCGTCCGGGGATTATG

Present study

 

SRS-rairA/R1

Rev

TAAGGTGCACGCAGTGGCAT

Present study

bax

SRS-bax/F1

Fwd

TCAAGGGATCTGGGAAGTGCT

Present study

 

SRS-bax/R1

Rev

ACCACTGCCTATCTTGCTCAACA

Present study

tnpA

SRS-tnpA/F1

Fwd

ACCTGTTAAGTTCTCGGCCATT

Present study

 

SRS-tnpA/R1

Rev

AGCCTTCACAAATGTCAACAAGTGA

Present study

elfP

SRS-elfP/F

Fwd

GCCACKGCTAATTCAGCAA

Present study

 

SRS-elfP/R

Rev

STGGAATGGTCAGCCACYT

Present study

The software KAKUSAN4 was used for construction of concatenated sequences of the 10 HK genes (8969 base pairs), calculation of substitution rate, and the best fit model for the individual loci and codon positions [17]. The data were exported into an MrBays-block (V. 3.2.2 x86) for analysis. The phylogenetic analysis was performed with Proportional Codon, Proportional model and a mcmc of 40 000 000 generations. The phylogram was constructed using TreeAnotator and viewed in FigTree [18]. A statistics report of percentage identity (PID) and average nucleotide identity (ANI) was made in GeneDoc (Karl Nicholas ©2000).

The multi locus sequence typing (MLST) method was applied as described by Apablaza et al. [14]. Briefly, the different allele types (AT) within the 10 HK were used to create the sequence types (ST). Based on the different STs, a data matrix from the 18 isolates of P. salmonis was exported as a nexus file into PAUP 4.0. A dendrogram was constructed using neighbor-joining (NJ) distance method.

All the nucleotide sequences were deposited in the GenBank database. Accession numbers are presented in Additional file 1: Table S1.

Results

Phenotypic characterization

The colonies grown on SRS-BA were slightly convex, grey-white, shiny, and centrally opaque with translucent, slightly undulating margins. At the microscopic level, the cells were Gram-negative, coccoid shaped, measuring from 0.4 to 1.8 μm in diameter. No distinctive colony or cell morphology differences were observed among the isolates.

The results of the growth at the different media are presented in Table 3. The minority of the isolates were classified as ‘fastidious’ (LF-89, Ch5-As-I, Ch6-Rt-L, and Ca20-As-K) while the rest of the isolates were defined as ‘less fastidious’. Five of the isolates (Ch3-Rt-L, Ch4-Rt-L, Ch5-As-I, Ch6-Rt-L and Ca20-As-I) grew on SRS-BA only. No growth was recorded on MA and FLPA media. The isolate Ch15-G2-As-I produced the highest number of colonies in SRS-BA. Ch14-As-I induced α- (dark green/brown discoloration around colonies) and β-hemolysis (medium translucence under the colonies) on BA with 2 % NaCl. This isolate grew on all the tested media, with exception of MA and FLPA (Fig. 2).
Table 3

Summary of growth of P. salmonis isolates on different culture media

Isolate

SRS-BA

CHAB

CHAB w/Fe

Austral-TSHem

BA

BA w/2 % NaCl

Ch11-As-I

+++

+++

+++

++

++

+++

Ch7-As-L

+++

+++

+++

++

++

++

Ch14-As-I

+++

++

++

++

++

+++

Ch9-As-na

+++

+++

+++

++

+

+

Ch13-As-I

+++

++

++

++

++

+++

Ch17-As-I

++

++

+

+

++

++

Ch2-As-I

+++

++

++

+

++

++

Ch12-As-I

+++

++

++

+

+

++

Ch15-As-I

+++

+

+

W

+

+

Ch10-As-I

++

++

++

+

+

++

Ch8-Rt-K

+++

+

+

+

+

+

Ch18-As-I

+++

+

+

+

-

+

Ca19-As-I

+++

++

++

-

+

+

Ch16-As-I

++

+

+

-

+

++

LF-89

+++

++

++

-

+

+

Symbols: (−), no growth; (+), scant growth; (++), moderate growth; (+++), vigorous growth; and (w), weak growth. Isolates Ch3-Rt-L, Ch4-Rt-L, Ch5-As-I, Ch6-Rt-L, and Ca20-As-I were grew only in SRS-BA

Fig. 2

Isolate Ch14-As-I cultured in eight different growth media: from upper left to the right, SRS-BA, CHAB, CHAB supplemented with ferric nitrate; Austral-TSHem; BA w/2 % NaCl, BA, MA, and FLPA

The maximum temperature range for the isolates growth was from 8 to 25 °C on SRS-BA (data not shown). Ch2-As-1, Ch7-As-L, Ch8-Rt-K, Ch12-As-I, Ch18-As-I, and Ca19-As-K had the ability to grow at 25 °C, while the type strain LF-89 did not grow at this temperature. After three days of incubation all isolates showed growth at 16, 19 and 22 °C. The optimum temperature for maximum growth was in the range 19–22 °C for the less fastidious isolates (including Ca19-As-K), and 16 to 19 °C for the remaining strains, including Ca20-As-K (Table 4).
Table 4

Optimum growth temperature for the P. salmonis isolates

Isolate

Optimum growing temp (°C)

LF-89

16–19

Ch2-As-I

16–19

Ch3-Rt-L

16–19

Ch4-Rt-L

16–19

Ch5-As-I

16–19

Ch6-Rt-L

16–19

Ca20-As-K

16–19

Ch7-As-L

19–22

Ch8-Rt-K

19–22

Ch9-As-na

19–22

Ch10-As-I

19–22

Ch11-As-I

19–22

Ch12-As-I

19–22

Ch13-As-I

19–22

Ch14-As-I

19–22

Ch15-As-I

19–22

Ch16-As-I

19–22

Ch17-As-I

19–22

Ch18-As-I

19–22

Ca19-As-K

19–22

The study of the antibiotic sensitivity of the isolates with respect to different antibiotics shows large variation in the inhibition zones. The strain Ch3-Rt-L seems to be resistant to the most of the antibiotics tested (Table 5). All isolates were sensitives to oxytetracycline, while florfenicol yielded the largest inhibition zones with the exception of above mentioned strain. Ch10-As-I had the largest inhibition zones in all antibiotics with the exception of penicillin.
Table 5

Antibiotic inhibition zones (mm) of the P. salmonis isolates

Isolate

Streptomycin

Oxytetracycline

Penicilin

Ceftazidime

Ampicilin

Florfenicol

LF-89

5

23

12

15,5

19,5

24

Ch2-As-I

0,5

0,5

1,5

10

3

14,5

Ch3-Rt-L

3,5

8,5

0,5

0,5

2,5

4

Ch4-Rt-L

2

18

6,5

17,5

14

19

Ch5-As-I

1

17

12

16,5

12,5

19,5

Ch6-Rt-L

0

16,5

13

15,5

13

18

Ch7-As-L

0

10

10

13,5

10,5

14,5

Ch8-Rt-K

1

21

2

13,5

13,5

24,5

Ch9-As-na

2

25

7

16

9,5

24

Ch10-As-I

32,5

27,5

1,5

18,5

22

23,5

Ch11-As-I

1

21

4

5

7,5

19

Ch12-As-I

0,5

17

9,5

12,5

1,5

22

Ch13-As-I

0,5

22

2,5

10

10

25

Ch14-As-I

0

22

9,5

11,5

11,5

24,5

Ch15-As-I

1

20

6

12

9

20,5

Ch16-As-I

0

3,5

6,5

12,5

8

17,5

Ch17-As-I

0,5

24,5

5,5

11

14,5

23

Ch18-As-I

2,5

20

0

10

1,5

15,5

Ca19-As-I

2

17

21,5

22

25

24,5

Ca20-As-I

2,5

24

13

13,5

15

27,5

Indole and oxidase tests were negative for all of the isolates, while catalase and cefinase tests were positive.

In the APY ZYM galleries, the results which differentiate the isolates are shown in Table 6. The tests were negative for all the isolates in the remaining enzymes included in the gallery. The Canadian isolate Ca19-As-I and the Chilean Ch8-Rt-K were the only ones positive for the enzyme esterase lipase and esterase, respectively. In addition, the isolate Ch14-As-I gave a positive reaction for β-galactosidase and α-glucosidase while the rest of the isolates were negative.
Table 6

P. salmonis differential enzymatic reactions in API ZYM galleries

Isolate

AP

E

EL

LA

VA

CA

AP

NP

LF-89

W

W

W

+

+

W

+

+

Ch2-As-I

W

W

W

+

+

W

W

Ch3-Rt-L

W

W

W

+

+

W

+

Ch4-Rt-L

W

W

W

+

+

W

+

Ch5-As-I

W

W

W

+

+

W

W

Ch6-Rt-L

W

W

W

+

+

W

+

+

Ch7-As-L

+

W

W

+

W

W

+

W

Ch8-Rt-K

+

+

W

W

W

+

W

Ch9-As-na

+

W

W

+

+

+

W

Ch10-As-I

+

W

W

+

+

+

+

+

Ch11-As-I

+

W

W

+

+

+

W

Ch12-As-I

+

W

W

+

+

+

+

Ch13-As-I

+

W

W

W

W

+

+

W

Ch14-As-I

+

W

W

+

+

+

+

Ch15-As-I

+

W

W

+

+

+

+

Ch16-As-I

+

W

W

+

+

+

W

Ch17-As-I

+

W

W

+

+

+

+

Ch18-As-I

+

W

W

+

+

+

+

Ca19-As-K

+

W

+

+

+

+

+

Ca20-As−K

+

W

W

+

+

+

+

W: weak reaction; +: positive reaction; −: negative reaction

Table 7

Overview of the number of variable nucleotide and putative aminoacids positions in the alignment of 16S rDNA, ITS and the ten housekeeping genes of P. salmonis included

Gene

N

No. Nucleotides

Variable positions

%

No. Amino acids

Variable positions

%

16S

18

1433

14

1,0

-

-

-

ITS

18

765

34

4,4

-

-

-

dnaK

18

1684

66

3,9

560

3

0,5

groEL

18

1454

73

5,0

484

10

2,1

tbpB

18

1879

95

5,1

626

26

4,2

mltB

18

843

20

2,4

280

5

1,8

ospA

18

364

14

3,8

121

3

2,5

radA

18

906

37

4,1

301

5

1,7

airA

18

407

21

5,2

135

6

4,4

bax

18

612

18

2,9

203

9

4,4

tnpA

18

356

20

5,6

118

5

4,2

elfP

18

473

26

5,5

157

0

0,0

MLST

216

11176

438

4,1

2985

7,2

2,6

Symbols: N: number of P. salmonis sequences

Genetic characterization

Phylogenetic analysis of the 18 partial (2198 bp) sequences of the 16S rDNA-ITS genes identified two clades (G1 and G2) as shown in the Fig. 3. The Canadian isolates are distinct and belong to the same branch in the phylogenetic tree. The analysis of the genetic relationships of the concatenated HKs is presented in Fig. 4. After several PCR attempts it was not possible to obtain all the expected PCR products for the isolates Ch13-As-I and Ch9-As-na, therefore they were not includes in the genetic analysis.
Fig. 3

The phylogenetic relationships of the 18 isolates of P. salmonis, based in the analysis of 2198nt within 16S rDNA-ITS genes. The phylogenetic tree was obtained by Mega 6.05 software. The codes for all the isolates are explained in the Table 1

Fig. 4

The genetic relationships of the 18 isolates of P. salmonis, based in the analysis of concatenated HK. The phylogenetic three was obtained by the mrBayes software. The codes for all the isolates are explained in the Table 1

Comparison of 10 housekeeping sequences from the isolates, included in the MLST scheme, revealed 438 variable nucleotide positions across 11176 nucleotides (nts) (Table 7). The highest percentage of variable nucleotide positions (5.6 %) was seen in the tnpA locus and the lowest (2.4 %) in mltB. The putative amino acid sequence showed variation in 7.2 positions of a total of 2985 amino acids. The highest percentage of variable amino acid positions (4.4 %) was seen in the airA and bax loci; and the lowest (0.0 %) in elfP. In the analysis of the genetic relationships of P. salmonis isolates, based in the analysis of concatenated HK, it were found two clades with similar grouping shown by the phylogenetic analysis of 16S rDNA-ITS genes. However, a better separation was seen in the clades G1 and G2 (Fig. 4).

The MLST analyses (Fig. 5) resulted in 12 STs based on the different ATs. The Chilean isolates presented 10 STs and the Canadian, two. The MLST analysis reflects the 16S rDNA-ITS phylogeny, arranging the isolates in three groups (Fig. 5).
Fig. 5

Dendrogram showing the sequence type relations in the multilocus sequence typing scheme (MLST) of the 18 isolates of P. salmonis. The MLST analysis was constructed using 11176nt from the HK dnaK, groEL, trpB, mltB, ospA, radA,alr, bax, tnpA, and elfP. The analysis was performed using the distance method in PAUP 4.0. The codes for all the isolates are explained in the Table 1

Discussion

The present study shows the 18 Chilean P. salmonis isolates as two genetically distinct groups, a separation supported by all three genotyping methods. Clade G1, containing isolates from Puerto Montt area and two isolates from Chiloe; and clade G2, including isolates retrieved from sites along the East coast of Chiloé Island and Melinka Island (Fig. 1). The present study, which does not included European isolates, clearly shows that the 18 Chilean isolates are genetically distinct from the two Canadian isolates of P. salmonis (Figs. 3, 4 and 5). Previous studies have shown genetic variations among Chilean isolates of P. salmonis and that Chilean strains are more genetically related to each other than to European and Canadian isolates [1921]. However, these phylogenetic studies have only consisted of five or less Chilean isolates [19, 20], and were therefore not able to have sufficient resolution to separate them in phylogenetic clades.

All three genetic methods used in this study are suitable for separation of P. salmonis isolates, and we present the first MLST typing system for P. salmonis. However, more isolates from a wider geographical area are needed for mapping of geographical distribution, reservoirs, possible transmission routes, host specificity, and variation in tissue tropism. Other methods, like variable number of tandem repeats (VNTR), giving a better separation of the isolates, are needed for studies of virulence.

The isolates studied were separated in two groups under the optimum growing temperature tests which correlate to a large extent with the results of genotyping. An optimal cultivation temperature at 16–19 °C was seen for isolates includes in clade G1 isolates confirming the findings of Fryer et al. [22]. Whereas, the less fastidious isolates, included in clade G2, had an optimal temperature between at 19–22 °C, which correlates with data presented by Mikalsen et al. [10].

The Canadian isolates differed both in genetic and phenotypic characteristics, as both were isolated from the same site during a contemporary outbreak SRS, showing that two different strains of P. salmonis can occur during a single outbreak of SRS.

Comparison of the different culture media clearly shows that SRS-BA is the best medium for culturing all the isolates included. Ch14-As-I had the fastest growth and was the only isolate positive for β-galactosidase and α-glucosidase in the API ZYM test. The presences of α-glucosidase and β-galactosidase have also been described to vary for strains of the related intracellular bacterium Francisella philomiragia subsp. philomiragia [23]. β-galactosidase and α-glucosidase participate in metabolic pathways in Gram negative bacteria [24] and might influence the bacterial growth.

Conclusions

This is the first study showing that there are two genetic groups of P. salmonis present in Chile, and that more than one strain of P. salmonis can occur under a contemporary outbreak of SRS. The two Canadian isolates were genetically separate when compared to the 18 Chilean isolates, although belong to the same branch. Other isolates should be included in further genotyping studies on Canadian strains of P. salmonis. The genotyping methods used are suitable for separation of the isolates; however, other molecular tools are most likely needed for separating isolates with different virulence. The phenotypic tests showed variation among the isolates, with the temperature test giving the best separation. In future studies the SRS-BA should be the preferred agar for isolation and culturing of P. salmonis. Studies of geographical distribution and host specificity will have to include more isolates from different fish hosts in all areas with production of salmonids and presence of P. salmonis.

The MLST and the sequences alignments for 16S rRNA-ITS and the concatenated housekeeping genes are made available at the TreeBASE data base (http://purl.org/phylo/treebase/phylows/study/TB2:S18993).

Availability of supporting data

The nucleotide sequences are deposited in the GenBank data Base DOI http://www.ncbi.nlm.nih.gov/genbank/. The accession numbers are presented in the Additional file 1: Table S1.

Abbreviations

ANI: 

average nucleotide identity

DSB: 

defibrinated sheep blood

HK: 

housekeeping genes

ITS: 

internal transcriber space

MA: 

marine agar

MLST: 

multi locus of sequence typing

RO: 

reverse osmosis water

RSS: 

red sea salt

SRS: 

salmonid rickettsial septicemia

SRS-BA: 

salmonid rickettsial septicemia-blood agar

TSA: 

tryptic soy agar

VNTR: 

variable number of tandem repeats

Declarations

Acknowledgements

Thanks to the field veterinarians Luis Almonacid, Carlos Bertin and Karin Ruiz (Cermaq Chile), and Kathleen Frisch (Cermaq Canada), for providing detailed description of the clinical findings of SRS in the different host species. This work was financed by a collaboration project between Cermaq Chile, Cermaq Group AS, Norway, and the University of Bergen.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Fish Diseases Research Group, Department of Biology, University of Bergen
(2)
Cermaq Group AS
(3)
MSD Animal Health
(4)
Cermaq Chile
(5)
Cermaq Canada

References

  1. Portnoy DS, Hollenbeck CM, Vidal RR, Gold JR. A comparison of neutral and immune genetic variation in Atlantic salmon, Salmo salar L. in Chilean aquaculture facilities. PLoS ONE. 2014;9(6):e99358.View ArticlePubMedPubMed CentralGoogle Scholar
  2. Sernapesca. Report of the use of antimicrobials in the national salmoniculture. National Service of Fisheries, Subdivision of Aquaculture, Animal Health Unit. Chile; 2015. (In Spanish).Google Scholar
  3. Fryer JL, Hedrick RP. Piscirickettsia salmonis: a Gram-negative intracellular bacterial pathogen of fish. J Fish Dis. 2003;26(5):251–62.View ArticlePubMedGoogle Scholar
  4. Rozas M, Enríquez R. Piscirickettsiosis and Piscirickettsia salmonis in fish: a review. J Fish Dis. 2014;37(3):163–88.View ArticlePubMedGoogle Scholar
  5. Kuzyk MA, Burian J, Machander D, Dolhaine D, Cameron S, Thornton JC, Kay WW. An efficacious recombinant subunit vaccine against the salmonid rickettsial pathogen Piscirickettsia salmonis. Vaccine. 2001;19(17–19):2337–44.View ArticlePubMedGoogle Scholar
  6. Wilhelm V, Huaracan B, Martínez R, Rosemblatt M, Burzio LO, Valenzuela PDT. Cloning and expression of the coding regions of the heat shock roteins HSP10 and HSP16 from Piscirickettsia salmonis. Biol Res. 2003;36(3–4):421–8.PubMedGoogle Scholar
  7. Tobar JA, Jeréz S, Caruffo M, Bravo C, Contreras F, Bucarey SA, Harel M. Oral vaccination of Atlantic salmon (Salmo salar) against salmonid rickettsial septicaemia. Vaccine. 2011;29(12):2336–40.View ArticlePubMedGoogle Scholar
  8. Fryer JL, Lannan CN, Giovannoni SJ, Wood ND. Piscirickettsia salmonis gen. nov., sp. nov., the causative agent of an epizootic disease in salmonid fishes. Int J System Bacteriol. 1992;42(1):120–6.View ArticleGoogle Scholar
  9. Mauel MJ, Ware C, Smith PA. Culture of Piscirickettsia salmonis on enriched blood agar. J Vet Diag Inv. 2008;20(2):213–4.View ArticleGoogle Scholar
  10. Mikalsen J, Skjaervik O, Wiik-Nielsen J, Wasmuth MA, Colquhoun DJ. Agar culture of Piscirickettsia salmonis, a serious pathogen of farmed salmonid and marine fish. Fems Microbiol Letters. 2008;278(1):43–7.View ArticleGoogle Scholar
  11. Yañez AJ, Silva H, Valenzuela K, Pontigo JP, Godoy M, Troncoso J, Romero A, Figueroa J, Cárcamo JG, Avendaño-Herrera R. Two novel blood-free solid media for the culture of the salmonid pathogen Piscirickettsia salmonis. J Fish Dis. 2013;36(6):587–91.View ArticlePubMedGoogle Scholar
  12. Cepeda C, García-Márquez S, Santos Y. Improved growth of Flavobacterium psychrophilum using a new culture medium. Aquaculture. 2004;238(1–4):75–82.View ArticleGoogle Scholar
  13. Justesen US, Acar Z, Olsson K, Jensen TG, Kerrn MB, Skov RL, Gahrn-Hansen B. Comparison of Rosco Neo-Sensitabs with Oxoid paper disks in EUCAST disk diffusion antimicrobial susceptibility testing on Mueller-Hinton agar. Eur J Clin Microbiol Infect Dis. 2013;32(5):621–5.View ArticlePubMedGoogle Scholar
  14. Apablaza P, Loland AD, Brevik OJ, Ilardi P, Battaglia J, Nylund A. Genetic variation among Flavobacterium psychrophilum isolates from wild and farmed salmonids in Norway and Chile. J Appl Microbiol. 2013;114(4):934–46.View ArticlePubMedGoogle Scholar
  15. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol Biol Evol. 2013;30:2725–9.View ArticlePubMedPubMed CentralGoogle Scholar
  16. Hasegawa M, Kishino H, Yano T. Dating the human-ape split by a molecular clock of mitochondrial DNA. J Mol Evol. 1985;22:160–74.View ArticlePubMedGoogle Scholar
  17. Tanabe AS. Kakusan4 and Aminosan. two programs for comparing nonpartitioned, proportional and separate models for combined molecular phylogenetic analyses of multilocus sequence data. Mol Ecol Res. 2011;11(5):914–21.View ArticleGoogle Scholar
  18. Drummond AJ, Suchard MA, Xie D, Rambaut A. Bayesian phylogenetics with BEAUti and the BEAST 1.7. Mol Biol Evol. 2012;29(8):1969–73.View ArticlePubMedPubMed CentralGoogle Scholar
  19. Reid HI, Griffen AA, Birkbeck TH. Isolates of Piscirickettsia salmonis from Scotland and Ireland show evidence of clonal diversity. Appl Env Microbiol. 2004;70(7):4393–7.View ArticleGoogle Scholar
  20. Mauel MJ, Giovannoni SJ, Fryer JL. Phylogenetic analysis of Piscirickettsia salmonis by 16S, internal transcribed spacer (ITS) and 23S ribosomal DNA sequencing. Dis Aquatic Org. 1999;35(2):115–23.View ArticleGoogle Scholar
  21. Heath S, Pak S, Marshall S, Prager EM, Orrego C. Monitoring Piscirickettsia salmonis by denaturant gel electrophoresis and competitive PCR. Dis Aquatic Org. 2000;41(1):19–29.View ArticleGoogle Scholar
  22. Fryer JL, Lannan CN, Garces LH, Larenas JJ, Smith PA. Isolation of a rickettsiales-like organism from diseased coho salmon (Oncorhynchus kisutch) in Chile. Fish Pathol. 1990;25(2):107–14.View ArticleGoogle Scholar
  23. Ottem KF, Nylund A, Karlsbakk E, Friis-Moller A, Kamaishi T. Elevation of Francisella philomiragia subsp noatunensis Mikalsen et al. (2007) to Francisella noatunensis comb. nov. [syn. Francisella piscicida Ottem et al. (2008) syn. nov.] and characterization of Francisella noatunensis subsp. orientalis subsp. nov., two important fish pathogens. J Applied Microbiol. 2009;106(4):1231–43.View ArticleGoogle Scholar
  24. Juers DH, Heightman TD, Vasella A, McCarter JD, Mackenzie L, Withers SG, Matthews BW. A structural view of the action of Escherichia coli (lacZ) beta-galactosidase. Biochemistry. 2001;40(49):14781–94.View ArticlePubMedGoogle Scholar
  25. Giovannoni SJ, Rappe MS, Vergin KL, Adair NL. 16S rRNA genes reveal stratified open ocean bacterioplankton populations related to the Green Non-Sulfur bacteria. Proc Natl Acad Sci U S A. 1996;93(15):7979–84.View ArticlePubMedPubMed CentralGoogle Scholar

Copyright

© Otterlei et al. 2016

Advertisement