Skip to content

Advertisement

Open Access

Influence of silver nanoparticles on growth and health of broiler chickens after infection with Campylobacter jejuni

BMC Veterinary ResearchBMC series – open, inclusive and trusted201814:1

https://doi.org/10.1186/s12917-017-1323-x

Received: 9 June 2017

Accepted: 18 December 2017

Published: 2 January 2018

Abstract

Background

Silver nanoparticles (AgNP) have gained much attention in recent years due to their biomedical applications, especially as antimicrobial agents. AgNP may be used in poultry production as an alternative to the use of antibiotic growth promoter. However, little is known about the impact of oral administration of AgNP on the gut microbiota and the immune system. The aim of the present study was to investigate the effects of AgNP on growth, hematological and immunological profile as well as intestinal microbial composition in broilers challenged with Campylobacter jejuni (C. jejuni).

Results

AgNP did not affect the intestinal microbial profile of birds. The body weight gain and the relative weights of bursa and spleen were reduced when supplemented with AgNP. There was no difference with respect to packed cell volume. However, the plasma concentrations of IgG and IgM were lower in birds receiving AgNP compared to the non-supplemented control group. The expression of TNF-α and NF-kB at mRNA level was significantly higher in birds receiving AgNP.

Conclusions

The application of AgNP via the drinking water in the concentration of 50 ppm reduced broiler growth, impaired immune functions and had no antibacterial effect on different intestinal bacterial groups, which may limit the applicability of AgNP against C. jejuni in broiler chickens.

Keywords

Broiler chickensSilver nanoparticlesMicrofloraImmunoglobulinsGene expression

Background

In broiler production, different kinds of antimicrobial agents are used for preventing and controlling diseases. Antimicrobials can affect the host intestinal flora, by reducing the colonization of intestinal bacteria, inhibiting the growth of pathogenic microorganisms, and enhancing the immune system, hence preventing diseases and improving animal performance [13]. However, the overuse of antimicrobial agents (antibiotics) promotes the emergence of antibiotic resistance in microorganisms [4], being harmful to animal and human health [5, 6]. For example, resistance to ciprofloxacin in Camplylobacter jejuni (C. jejuni) isolated from Danish broiler meat increased significantly from 0% in 2009 to 17% in 2010 [7]. The use of all antibiotics as growth promoter has been prohibited in the European Union since 2006 [2, 8]. Thus, there is a need to find alternatives to antibiotics in poultry production. When the conventional therapies, including antibiotics, anti-inflammatory agents, growth hormones, surgical interventions, and cytotoxic chemotherapies are ineffective in curing poultry infections, it is necessary to explore novel drug compounds. Nanoparticles have been emerging as one of the new treatment options, and their capability of penetrating normally intact physiologic barriers has reached a variety of molecular targets [9, 10].

Recent studies on antibacterial materials such as various natural (oils, acids), inorganic antimicrobial agents such as metals (Ag, Au, Cu) and metal oxides (ZnO, SiO2, Fe2O3, TiO2) have received increasing attention. Among metal nanoparticles, silver is one of the most promising components in several nanotechnology products. Currently, there are several consumer products containing various silver nanoparticles (AgNP) because of their antimicrobial properties [1114]. AgNP have been shown to have a wide range of antibacterial activities against both Gram-positive and Gram-negative bacteria, including major foodborne pathogens [1519]. At present, there is no study available on their antibacterial effect against C. jejuni being a leading cause of human gastroenteritis worldwide. It is mainly transmitted from contaminated chicken meat. Campylobacter infections are associated with the neurological disorder Guillain-Barre syndrome [20, 21]. A common feature of C. jejuni causes enterocolitis and is involved in acute inflammatory response that can lead to tissue damage and may be responsible for many of the clinical symptoms [22]. Furthermore, antimicrobial resistance was observed in C. jejuni and Campylobacter coli [23].

Although the antimicrobial effect of AgNP has been studied extensively, the mechanism of antibacterial activity specific to bacteriostatic or bactericidal activity remains unclear. Studies had shown that AgNP upon contact with water can release Ag + ions from their surface [24]. Free Ag + has a potent antimicrobial effect, which destroys microorganisms immediately by blocking the cellular respiration and disrupting the function of bacterial cell membranes. This occurs when Ag + binds to tissue proteins, causing structural changes in the bacterial cell membranes which, in turn, cause cell death. Essential protein complexes of the bacterial electron transport chains are located on the cell exterior and, therefore, are manageable for inactivation by reactive silver ions. Ag + also binds and denatures the bacterial DNA and RNA, thus inhibiting cell replication [25]. Recently, evidence has been obtained suggesting that silver nanoparticles may modulate the phosphotyrosine profile of putative bacterial peptides that could affect cellular signaling and, therefore, inhibit the growth of bacteria [26].

In recent years, several studies have been focused on anti-inflammatory therapy and on molecules which could block pro-inflammatory pathways. Nanoparticles of Ag and Au are considered anti-inflammatory agents or components of anti-inflammatory molecules [27, 28]. Moreover, in vivo studies with chicken embryos and quails showed that AgNP did not affect growth, development [29] and DNA oxidative damage to chicken embryos [30]. Results from toxicological assays have shown no in vitro cytotoxicity of AgNP (0.1, 0.5 and 1.0%) [17] but concentrations (2.5–50 μg/mL) of AgNP exert a cytotoxicity effect on human mesenchymal stem cells [31]. The most common health effects associated with chronic exposure to silver are a permanent grey or blue-grey discoloration of the skin (argyria). From the immunological perspective, it is known that phagocytosis of AgNP stimulates inflammatory signaling through the generation of reactive oxygen species (ROS) in macrophage cells, followed by the activated macrophage cell-induced secretion of TNF-α. The increase of TNF-α level causes damage to the cell membrane and apoptosis [32]. An inadvertent recognition of AgNP as a foreign particle by the immune cells may result in a multilevel immune response and finally lead to toxicity in the host. However, when the AgNP are recognized as self or an absence of immune recognition, then their ability to stimulate immune response may decide the fate of AgNP in the host. In vivo studies have demonstrated that nanoparticles are capable of promoting inflammation or suppressing immune functions [3335]. The nanoparticle-induced inflammatory response may have an impact on immune defense, and the T-helper 1 (Th1)/T-helper 2 (Th2) balance [9, 36].

There are limited data regarding the effect of orally administered AgNP on the intestinal bacterial population and immune system of animals. In this study, we hypothesized that the antimicrobial properties of colloidal solutions of AgNP may affect the microbial population and immune responses upon challenge. The use of AgNP in poultry production may potentially function as an alternative to the use of antibiotic based growth promoters. The objective of this study was to investigate the effect of AgNP on the growth, the microbial profile of digestive tract and the immune status of broilers exposed to C. jejuni infection. In this study, we used hydrocolloid of AgNP because they exhibit high surface/volume ratio which may effectively enhance the bactericidal activity. In addition, chicks were used as an animal model for bacterial GI infection.

Methods

Experimental solution

The hydrocolloid of AgNP obtained from Nano-Tech (Warsaw, Poland) was produced by an electric non-explosive patented method (Polish Patent 3,883,399) from high purity metals (99.9999%) and high purity demineralized water. The concentration of the hydrocolloid was 50 mg/kg (50 ppm). The shape and size of nanoparticles were inspected by transmission electron microscopy (TEM), the particles had a crystal structure with an average size of 3.5 nm. The average surface area was 2.827 × 10−13 cm2 and the pH of the colloidal silver solution was 7.1 to 8.1 (data provided by Nano-Tech, Poland). Furthermore, more detailed information regarding the applied AgNP are given by Sawosz et al., 2011 [18].

Experimental design

Ninety day-old male broiler chickens (Ross 308), obtained from a Danish commercial hatchery (DanHatch, Vrå, Denmark) were used. Upon arrival at the laboratory, the birds were wing-labeled, weighed and randomly distributed to two experimental groups: control, no AgNP, and provided with 50 ppm of AgNP in the drinking water. Furthermore, prior to the experiment antibacterial tests were done at in vitro level.

The chickens were housed in six individual isolators with 15 birds per isolator. The room temperature was 32 °C at the beginning of the experiment and was gradually decreased according to the demands of the growing chickens. The humidity was maintained during the experiment. Over the entire experimental period, both experimental groups were fed the same diet as described in Table 1. Drinking water was provided via nipple drinkers placed in the isolators. Birds were inspected every day and for every 2 days water and fed consumption were recorded. All birds had free access to food and water.
Table 1

Composition of the diet for broiler chickens (g/kg)

Ingredients

Wheat

49.9

Maize

10.0

Rape seed (LL), grounded

4.00

Soybean meal (de-hulled, toasted)

29.4

Soybean oil

2.45

Calcium carbonate

0.90

Monocalcium phosphate

1.56

Sodium chloride

0.20

Natrium-bicarbonate

0.27

Lysine hydrochloride (100%)

0.25

DL-Methionine (100%)

0.35

Threonine (98%)

0.10

Vitamins and minerals

(Vitfoss, Slut, 0.5%)

0.60

Total

100

At day 11, all chickens were weighed and cloacal swab samples of 5 chickens per isolator were taken and examined for the presence of C. jejuni colonies for initial observation. Subsequently, two birds were randomly selected from each treatment and killed, and then blood samples were collected for packed cell volume (PCV) determination before samples of liver tissue were collected for gene expression studies. Afterwards, the chickens were orally challenged with 0.5 mL of an overnight culture of C. jejuni (4 × 107/ mL per bird). The infection strain (DVI-sc181) has been isolated from infected commercial broilers and provided by the Technical University of Denmark, National Veterinary Institute.

On days 15, 22 and 30, all chickens were weighed, and 5 chickens per isolator were randomly chosen. Blood samples were taken from the jugular vein and the chickens were immediately sacrificed by cervical dislocation. Liver, heart, spleen and bursa were collected, weighed and stored at -80 °C for further analysis. Ileum and caecum were collected to enumerate intestinal bacteria.

Enumeration of Campylobacter and selected groups of intestinal bacteria

C. jejuni were enumerated in intestinal contents of ileum, caecum and faeces from 5 chickens per isolator at each sampling day. The samples (approximately 3 g) were homogenized, and serially diluted in 10-fold in phosphate buffered saline and plated on modified blood free charcoal cefoperazone deoxycholate agar base (Oxoid, CM0739). The plates were incubated with C. jejuni specific growth supplements at 42 °C for 48 h under microaerobic conditions (5% O2, 5% CO2, 5% H2, and 85% N2). Enterobacteria (E. coli and lactose negative enterobacteria) were enumerated on MacConkey agar (Merck, Darmstadt, Germany, 1.05465) incubated aerobically at 37 °C for 24 h as described by Engberg et al. [37]. Lactic acid bacteria (LAB) and Clostridium perfringens were counted respectively on De Man Rogosa Sharpe agar (Merck, 1.10660) incubated anaerobically at 37 °C for 48 h and tryptose sulphite cycloserine plates (TSC-Agar, Merck, 1.11072) incubated anaerobically at 37 °C for 24 h. Enterococci were counted on Slanetz and Bartely plates (Merck, 1.05289) after aerobic incubation at 37 °C for 48 h. The results are presented as microbial number (CFU/g) in ileal/caecal or faecal material. The detection limit was 10 2 bacteria/g. During the experiment, water samples were collected from the drinkers in the isolators and the antimicrobial effect of AgNP on C. jejuni was investigated in in vitro using the plate count method.

Hematology

Before cervical dislocation, blood was collected by puncture of the jugular vein in disposable sodium heparinized hematocrit capillary tubes (Camlamb Ltd., Cambridge, UK). The tubes were filled up to two-thirds and sealed with cristaseal (Hawksley, Sussex, UK). The percentage of packed cell volume (PCV) was measured by using a micro-hematocrit reader (Hearaeus Reader, Osterode, Germany).

Concentrations of plasma immunoglobulins

From 5 chickens, blood samples were drawn from the jugularis vein and were collected in heparinized tubes. Blood samples were subsequently placed on ice, centrifuged at 2000 g for 10 min at 4 °C, and the plasma was stored at −20 °C until analysis of immunoglobulins. The concentrations of IgA, IgM and IgG were measured. Chicken plasma specific antibodies such as IgA (Bethyl laboratories, cat. no. E33–103), IgG (Bethyl laboratories, cat. no. E33–104) and IgM (Bethyl laboratories, cat. no. E33–102) concentrations were determined in diluted samples (1:100) by enzyme-linked immunosorbent assay (ELISA) using microtiter plates (NuncImmunoplate 96-well, cat. no. 446612) as per manufacturer’s ELISA quantitation kits (Bethyl Laboratories Inc., Montgomery, TX, USA).

Measurement of the content of specific chicken antibodies was done by indirect ELISA as follows: microtiter plate wells were coated with 100 μl of diluted coating antibody (1:200) to all wells and incubated for 2 h at room temperature (RT). After incubation, coated plates were washed with washing solution pH 8.0 (0.05 M Tris, 0.15 M NaCl, 10% Tween 20) to eliminate excess capture antibodies. Wells were incubated with 200 μl blocking buffer pH 8.0 (0.05 M Tris, 0.15 M NaCl, 1% BSA) on a shaker for 30 min at RT to block nonspecific protein binding and then washed 3 times with washing solution.

For the determination of immunoglobulins (IgG, IgM, or IgA), plasma samples were diluted and 100 μl of diluted plasma was added in triplicate. Plasma dilutions were 1:3000 for IgM, 1:1000 for IgA and 1:25,000 for IgG. Concentrations of IgG, IgM, and IgA in the standards were 6.25 mg/ml, 0.4 mg/ml, and 0.38 mg/ml respectively. Standards were diluted for IgG ranging from 200 ng/ml to 3.12 ng/ml, for IgM from 250 ng/ml to 3.9 ng/ml and for IgA from 1000 ng/ml to 15,625 ng/ml. The concentrations of immunoglobulins in test plasma samples were determined using these standard curves. The plates were incubated for 1 h at RT and were washed three times in washing solution. 100 μl of (horseradish-peroxidase) HRP detection anti-chicken IgM (A30-102P) was diluted 1:75,000 and for anti-chicken IgA (A30-103P) and IgG (A30-104P) were diluted 1:50,000 in conjugate diluent pH 8 (0.05 M Tris, 0.15 M NaCl, 10% Tween 20) was added to each well and the plates were allowed to incubate for 1 h at RT. After incubation, to remove unbound peroxidase-conjugates, each well was washed with washing solution for 3 times. 100 μl of (3,3,5,5-tetramethylbenzidine) TMB substrate was added to each well to determine bound peroxidase, and after incubation for 5–15 min in the dark at RT, 100 μl of 1 M H2SO4 was added to each well to stop the TMB reaction. The optical density was measured at 450 nm and expressed as ng of IgA, IgM and IgG per ml of plasma with a microplate reader. Using the mean absorbance value for each sample, determines the corresponding concentration of immunoglobulins in ng/ml from the standard curve.

Gene expression of TNF-α and NF-kB

Liver tissue samples (approximately 30 mg) were homogenized in TRIzol® Reagent (Invitrogen, Carlsbad CA, USA, cat. no. 15596–018). Then, RNA clean-up was performed and total RNA was extracted according to the manufacturer’s protocol using SV Total RNA isolation system (Promega Corporation, Madison, WI, USA, cat. no. Z3105). Final RNA preparations were resuspended in RNase-free water and stored at -80 °C. The content of isolated RNA was quantified by UV-spectroscopy at 260 nm/280 nm with a NanoDrop® ND-1000 Spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Further quality was assessed by Agilent 2100 bioanalyser (Agilent RNA 6000 Nano kit, Waldbronn, Germany) and more than 6.5 RNA integrity number values were considered for cDNA preparation.

Two mg of total RNA was reverse-transcribed using the cDNA Reverse Transcription Kit (Promega, cat. no. A3500) in a G-storm PCR System. After this, real-time PCR was performed with complementary DNA and gene-specific primer pairs (TAG, Copenhagen A/S, Copenhagen, Denmark) mixed with LightCycler®480 SYBR Green I Master mix (Roche Applied Science, Penzberg, Germany) in a LightCycler® 480 real-time PCR system (Roche Applied Science). The cycling conditions included an initial heat step at 95 °C for 5 min, denaturation at 95 °C for 10 s, annealing temperatures described in Table 2 for each of the primers and product elongation at 72 °C for 20 s for 45 cycles. Following amplification, the melting curve was conducted on each sample to ensure that a single product was obtained using three-segment cycle of 95 °C for 5 s, 65 °C for 1 min and 95 °C no hold for continuous-acquisition mode with a heating rate of 0.11 °C/s and 5 acquisitions per 1 °C). Characterization of the product size was, furthermore, confirmed by agarose gel electrophoresis and sequencing (Bechman coulter genomics Takeley, UK). Results were quantified based on the relative expression of the TNF-α and NF-kB genes versus the housekeeping genes GAPDH and ACTB using advanced relative quantification (Efficiency method) by Light Cycler 480 Software release 1.50 SP4. The gene expression experiment was repeated 2 times chemically with consistent results and three replicates were used per sample each time.
Table 2

Genes and primers used in the study

RNA target gene

Primer sequences(5′–3′)

PCR Product

Gene bank Assess. No

Annealing Temperature

Amplicon (bp)

GAPDH

   

NM_204305.1

Forward

TGCTGCCCAGAACATCAT

61 °C

199

 

Reverse

ATCAGCAGCAGCCTTCAC

   

ACTB

   

NM_205518.1

Forward

GTCCACCTTCCAGCAGATGT

60 °C

169

 

Reverse

ATAAAGCCATGCCAATCTCG

   

NF-kB

   

M86930.1

Forward

TTGCTGCTGGAGTTGATGTC

60 °C

167

 

Reverse

TTGCTGCTGGAGTTGATGTC

   

TNF-α

   

NM_204267.1

Forward

TTCAGATGAGTTGCCCTTCC

59 °C

150

 

Reverse

TCAGAGCATCAACGCAAAAG

   

GAPDH Glyceraldehyde-3-phosphate dehydrogenase, ACTB Actin beta, NF-kB nuclear factor kappa B, and TNF-α Tumor necrosis factor alpha

Statistical analysis

The data were analyzed using the GLM procedure of SAS (SAS Institute Inc., 2008) 9.2 version for windows considering the treatments (AgNP vs. non-supplemented control), the day of age (15, 22 and 30) and interactions between treatment and age. Tukey-Kramer significant different test was employed to test the separation of the means and differences were considered statistically significant when the p ≤ 0.05.

Results

Enumeration of bacteria

There were no differences between birds receiving AgNP and the control group (Fig. 1) with respect to the numbers of C. jejuni, lactic acid bacteria, Enterococci, Clostridium perfringens, Escherichia coli, and Lactose negative enterobacteria in the contents of caecum, ileum and feces of the birds.
Figure 1
Fig. 1

Influence of AgNP administration in broiler chickens after challenge with C. jejuni on microbial profile in caeca, ileum and feces. At 15, 22, and 30 days of age, samples (n = 30 for each time point) were used for microbial count. Error bars represent the mean and standard errors of 6 isolators each with 15 birds

The influence of AgNP on feed and water intake

AgNP had no effect on the average daily water intake (ADWI), average daily feed intake (ADFI) and feed conversion ratio (FCR = ADFI/ ADWG) (Table 3). The average daily weight gain (ADWG) was significantly lower in birds receiving AgNP compared to the control birds, in the periods 0–11 days (p = 0.007), 11–15 days (p = 0.002) 15–22 days (p = 0.003) but not in 22–30 days (p = 0.728). The average amount of AgNP which single chicken received in the drinking water was 8.26 mg/d (Additional file 1: Table S1).
Table 3

Effect of silver nanoparticles (AgNP) on daily feed and water intake, weight gain and feed conversion ratio of chickens infected with C. jejuni

Parameters

Mean

Pooled

Treatment*Age

(g/bird)

Control

AgNP

SE

p-value

ADWI

 Day 0–30

161

165

0.34

0.64

ADFI

 Day 0–30

97.0

102

0.17

0.16

ADWG

 Day 0–11

21.7a

18.7b

  

 Day 11–15

43.7a

38.6b

  

 Day 15–22

62.7a

57.4b

  

 Day 22–30

70.5

69.4

  

 Day 0–30

46.6

44.9

0.03

0.34

FCR

 Day 0–30

1.97

2.22

0.04

 

*Indicates interaction

Values are mean of 6 isolators each with 15 birds

SE pooled standard error, ADWI Average daily water intake (g per bird), ADFI Average daily feed intake (g per bird), ADWG Average daily weight gain (g per bird) and FCR Feed conversion ratio

a,b values within rows with different superscripts are significantly different at p <0.05

The effect AgNP on chicken body weight and relative organ weights

The body weight of birds supplemented with AgNP was significantly lower than that of control bids (Table 4). Significant interactions between age and treatment were observed for the relative weight of bursa and spleen, where a lower relative bursa at age 15, and for spleen at age 30 were noticed for AgNP group. Relative organ weights of heart and liver were not different between the control birds and birds supplemented with AgNP.
Table 4

Effects of silver nanoparticles (AgNP) on cumulative body and relative organ weight gain (g/kg) in C. jejuni infected broiler chickens

Parameters (g/bird)

Mean

Pooled

Treatment*Age

Control

AgNP

SE

p-value

AWG

 Age 15

380a

318b

  

 Age 22

788a

722b

  

 Age 30

1424a

1346b

0.305

0.013

Heart

 Age 15

0.71

0.70

  

 Age 22

0.62

0.66

  

 Age 30

0.47

0.50

9.17

0.340

Bursa

 Age 15

0.25 a

0.20b

  

 Age 22

0.21

0.22

  

 Age 30

0.20

0.20

5.08

0.003

Spleen

 Age 15

0.09

0.11

  

 Age 22

0.07

0.07

  

 Age 30

0.07a

0.05b

2.31

<0.001

Liver

 Age 15

2.71

2.82

  

 Age 22

2.52

2.56

  

 Age 30

2.01

2.00

0.003

0.657

Abnormalities

At age 30, big gall bladder was found from 2 out of 15 birds in AgNP group

*Indicates interaction

a, b values within rows with different superscripts are significantly different at p <0.05. SE – pooled standard error, AWG – average body weight gain. The relative organ weights (weight of organ/100 g live body weight). Values are mean of 6 isolators each with 15 birds

AgNP response on PCV

At days 15, 22 and 30 of age no significant difference between control birds and birds receiving AgNP was observed with respect to blood PCV levels (Fig. 2). Likewise, no effect of age was observed.
Figure 2
Fig. 2

Effect of silver nanoparticles (AgNP) on packed cell volume levels in chickens infected with C. jejuni. Error bars represent the mean values and standard errors of 6 isolators each with 15 birds

Plasma immunoglobulin concentrations

We observed significant interactions between treatment and age for the concentrations of IgA, IgG and IgM in plasma (Fig. 3). At day 30, the plasma concentration of IgA was higher in birds supplemented with AgNP than in control birds, whereas the opposite effect was observed at age 15 and 22 days (p = 0.05, Fig. 3a). At day 30, the concentration of IgG in plasma was significantly lower in birds receiving AgNP as compared to the control birds (Fig. 3b). At age 15, plasma concentrations of IgM were higher in the AgNP group than in the control group (Fig. 3c), whereas at day 22 and 30, the concentrations of IgM were lower (p < 0.05).
Figure 3
Fig. 3

Concentration of immunoglobulins (IgA, IgG and IgM) in chickens infected with C. jejuni Samples were analyzed at days 15, 22 and 30 of age; a) IgA b) IgG and c) IgM. Error bars represent the mean values and standard errors of 6 isolators, each with 15 birds. Interactions between treatment and age effect significantly (p < 0.05). * Indicates significant difference between control and AgNP (p < 0.05)

Gene expression of NF-kB and TNF-α

The influence of AgNP on the mRNA NF-κB and TNF-α expression in liver tissue of C. jejuni infected chickens is shown in Fig. 4. Interestingly, at day 30, the levels of NF-κB (Fig. 4a-c) and TNF-α expression (Fig. 4b-d) were increased (p < 0.05) in the group supplemented with AgNP compared to the control group.
Figure 4
Fig. 4

The expression of mRNA NF-κB and TNF-α normalized to the housekeeping genes ACTB and GAPDH in the liver tissue of chickens infected with C. jejuni. Samples were analyzed at days 15, 22 and 30 of age; a) NF-κB /ACTB, b) TNF-α /ACTB, c) NF-κB /GAPDH and d) TNF-α /GAPDH. Error bars represent the mean values and standard errors of 6 isolators, each with 15 birds. Interactions between treatment and age effect significantly (p < 0.05). * Indicates significant difference between control and AgNP (p < 0.05)

Discussion

In vitro antibacterial tests against C. jejuni showed a minimal inhibitory concentration of AgNP at the level of 40 and 50 ppm. AgNP have an effect on the target microorganism in the absence of chickens. In the present in vivo experiment, 50 ppm of AgNP was used because, prior to this experiment we carried out dose response studies to examine the antibacterial effect against C. jejuni of different concentrations of AgNP on chickens by chicken intestinal organ culture model (CIOC-model, Additional file 2: Table S2). The minimum inhibitory and minimum bactericidal concentration of silver nanoparticles on C. jejuni was determined by using the microtiter plate method (Additional file 3: Figure S1), showed bactericidal effect with minimum concentration of 50 ppm. We have evaluated samples of ileum, caecum and feces because of the uniformity of the gut microbiota in these segments. The caecum has a slow digesta passage rate, allowing to harbor a complex microbiome that has considerable effects on host nutrition and health [38]. The small intestinal region of the ileum has received attention since it is the principal site of nutrient absorption and microflora [39]. Furthermore, we focused on test samples at various time points because the caecal and ileal microflora changes in relation to age and dietary treatments [38, 39].

However, unexpectedly, AgNP did not change the microbial profile of caecum, ileum and feces of examined chickens (Fig. 1). These results are consistent with in vivo experiments with the microbial profile of young quails receiving hydrocolloids of AgNP administered with 5, 15 and 25 ppm [29]. Moreover, another study demonstrated that supplying AgNP did not effectively rescue Salmonella-mediated mortality in chickens but nanoscale silicate platelet (NSP) and its nanohybrid composite of AgNP/NSP effectively controlled the infection [40]. However, our present study was not similar with this study in terms of end point of examination, concentration of nanoparticles, bacterial infection time points and target bacterial species. The factors that could affect the present results might be the method of AgNP administration, although C. jejuni colonization in the intestinal tract depends on the number and diversity of environmental microorganisms, as well as influence of feedstuffs. The other possibilities could be the C. jejuni biofilm formation and adhesion to the host intestinal wall may provide protection against nanoparticles. The chicken intestinal mucus is able to attenuate C. jejuni virulence by inhibiting its ability to adhere and invade intestinal epithelial cells [41]. Furthermore, the antibacterial properties of AgNP could vanish inside the digestive tract environment of chickens, probably, due to AgNP agglomeration in the presence of low pH gastric acid. The obtained results may suggest that AgNP were gastro-sensitive, the stability and dispersion of AgNP in gastric acid is a critical factor for antibacterial activity. Once the particle enters a biological system, physical properties such as solubility, particle agglomeration, surface charge and particle-protein complex interactions might be different from those of the in vitro-measured properties. The loss of nanoparticles’ properties may be due to the low colloidal stability and the reduction of reactive surfaces may affect the efficacy for controlling pathogens in a solution [42].

The reduction in cumulative body weight and relative organ weights of the spleen and bursa of birds supplemented with AgNP might be due to the effect of AgNP blocking the intestinal absorption of actively transported sugars and amino acids, and decreased protein digestibility through the small intestine where mainly enzymatic activity is present. Another possible reason might be the fact that the birds undergo more cellular stress and excessive cellular interactions with AgNP. It appears that C. jejuni colonization may lead to weight loss in grower chickens. The present results are consistent with decreased body and organ weights in chickens treated with 25 ppm of AgNP at 42 days of age [43]. Moreover, the study of Asharani et al. [44] suggested that AgNP increase ROS production and interrupt ATP synthesis, leading to DNA damage and cell cycle arrest at G2/M phase. Park et al. [32] found that AgNP induce G1 phase arrest and a complete blockage of the S phase, with the induction of apoptosis. The AgNP (10 ppm) injected into fertilized eggs on days 5, 11 and 17 of incubation did not influence the development of embryos but decreased the number and size of lymph follicles in the bursa of Fabricius [45].

The PCV results indicated that the provision of AgNP did not influence the percentage of red blood cells (Fig. 2). On the other hand, it was reported that the oral administration of AgNP induced some changes in the red blood compartment, such as increased red blood cell count [46] and coagulation parameters [47].

The present results demonstrated age-related differences in immunoglobulin concentrations, which could probably be ascribed to the infection with C. jejuni on day 11 of age. Immunoglobulins are generally associated with immune resistance to extracellular bacteria and viruses or other foreign substances. Therefore, their levels might be most appropriate to study diseases caused by extracellular microorganisms [48]. Plasma immunoglobulin levels were measured following C. jejuni infection of chickens on days 15, 22 and 30 of age. Noticeable, significantly lower levels of IgG and IgM were observed in AgNP supplemented chickens (Fig. 3b-c). The decrease in the levels of IgG and IgM in AgNP birds might be due to the microbial colonization and provision of AgNP via drinking water. Importantly, the impaired T–cell function might be a reason for reduced IgG levels. AgNP might impair intestinal actively transported sugars, amino acids, trace elements, and vitamins, and deficiencies of these nutrients may decrease antibody formation. Similar observations showed decreased plasma IgG levels in chickens treated with 10 ppm and 20 ppm AgNP but not infected with C. jejuni [49]. Reduction of bursa and spleen weights may be correlated to the decreased IgG levels. Therefore, the expression of immunological effects in this study was assumed to be the result of AgNP impairment. It could be that lymphocyte production and self- or non-self-antigen selection against C. jejuni infection changes with age, and could also be influenced by AgNP. Our results suggested that AgNP can diminish the activity of humoral immunity of broiler chickens by decreasing the levels of immunoglobulins in plasma.

In the present study, NF-kB and TNF-α expression was determined in chicken liver tissue to evaluate whether or not AgNP could modify inflammation at the transcriptional level (Fig. 4). NF-κB and TNF-α expressions are important in Campylobacter colonization as C. jejuni primarily colonized the lower small intestine and caecum, where remarkable histopathologic and ultrastructural changes in the epithelium were noticed. In a novel rabbit model, the pathogen induced intestinal inflammation had increased levels of IFN-γ, TNF-α, IL-1β, IL-2, IL-6, IL-8, and IL-22 gene expression. In the acute phase, the bacteria induced a significant increase in the expression of the most pro-inflammatory genes [50]. The infection of human intestinal epithelium with Campylobacter results in activation of NF-kB, which is needed for the induction of pro-inflammatory genes [51]. We have recently observed that TNF-α mRNA expression was consistent with 50 ppm when AgNP were injected into chicken embryos after LPS stimulation during the 19th day [52]. Results concerning the mRNA expression of NF-kB were not in agreement with those of the chicken embryo liver [53]. We suppose that this could be due to the time of exposure, tissue specificity and route of administration of AgNP. However, our results confirm the pro-inflammatory activity of AgNP, which has been previously observed in chickens and mice [54, 55]. Furthermore, an increased inflammatory response of the AgNP group in comparison with the control group indicates an over-immunostimulation activity of AgNP. The ability of nanoparticles to freely move into local lymphoid tissues and trigger antigen-presenting cells might be responsible for their immunostimulatory activity.

The exact mechanism and reason how and where AgNP induce pro-inflammatory effects are not known, but it has been reported that they stimulate production of reactive oxygen species (ROS), and thereby modulate intracellular calcium concentrations, activate transcription factors, and induce cytokine production [56]. The toxicity of nanoparticles is manifested by inflammation resulting from oxidative stress [5759]. Recently, various studies with AgNP have been published, demonstrating conflicting results that silver nanoparticles are toxic [44, 5963] or non-toxic [6466]. Furthermore, they could be pro-inflammatory [47, 6769] or anti-inflammatory agents [27, 28, 65]. Importantly, particle size-dependent effects of AgNP were observed with respect to cellular uptake, pro-inflammatory response and changes at the proteome level [70]. The 20 nm AgNP elucidated a higher inflammatory response than the 200 nm particles in Caco-2/TC7 cells. It might be that bigger particles have different transport rates, reduced interaction with the cellular membranes and are better retained in the gastrointestinal epithelial mucous layer than smaller particles. Thus, smaller particles may cross the mucus layer and reach the cells.

An increase in mRNA expression of inflammatory mediators and low IgG and IgM levels could be due to the nanoparticle uptake triggering cellular effects, leading to inflammatory responses. However, the conflicting results might indicate that AgNP have multiple cellular targets that vary among different cell type. These results are attributed to several confounding factors such as pH [71], continuous oral administration of AgNP, [47, 68] or high concentration, [28] or even the availability of free radicals to induce oxidative stress and damage cells [58]. We propose that nanoparticles time of exposure, route of administration, particles size, aggregate formation, and altered bio-distribution in the form of rapid clearance owing to non-specific pathogen clearance from the systemic circulation could serve as aided factors. One possible cause for the AgNP dependent initiation of inflammation could be the fact that they enhance the production of ROS. These oxygen-derived free radicals may lead to mitochondrial dysfunction, increased gene expression of inflammatory cytokines (TNF-α) and activation of specific transcription factors (NF-kB). The absorption, distribution, metabolism, excretion, and toxicity of AgNP are largely dependent on their physicochemical properties and the surrounding environmental conditions. However, we were unable to find a mechanism involved in the pro-inflammatory pathway of AgNP in the present work and could not verify the presence of AgNP in the digestive organs.

Conclusions

Orally-administered AgNP via the drinking water (50 ppm) had no effect on the intestinal colonization of C. jejuni following infection and did not influence the intestinal microbial profile of broiler chickens. However, AgNP reduced body weight gain, lowered concentrations of plasma immunoglobulins and upregulated mRNA expression of TNF-α and NF-kB, indicating toxicity and impaired immune response. Thus, the use of orally administered AgNP might be harmful to the chicken health.

Abbreviations

ADFI: 

Average daily feed intake

ADWG: 

Average daily weight gain

ADWI: 

Average daily water intake

AgNP: 

Silver nanoparticles

C. jejuni

Camplylobacter jejuni

CCDA: 

Charcoal cefoperazone deoxycholate agar

CIOC: 

Chicken intestinal organ culture

E. coli

Escherichia coli

ELISA: 

Enzyme-linked immunosorbent assay

FCR: 

Feed conversion ratio

HRP: 

Horseradish-peroxidase

Igs: 

Immunoglobulins

LAB: 

Lactic acid bacteria

MRS: 

de Man Rogosa Sharpe

PCV: 

Packed cell volume

RIN: 

RNA integrity number

ROS: 

Reactive oxygen species

RT: 

Room temperature

TEM: 

Transmission electron microscopy

TMB: 

3,3,5,5-tetramethylbenzidine

TSC: 

Tryptose sulfite cycloserine

Declarations

Funding

This research work was supported by the Danish Agency for Science Technology and Innovation # 2106–08/0025.

Availability of data and materials

Data supporting the findings is found in the main paper and additional supporting files. Raw data files will also be shared by the corresponding author upon request.

Authors’ contributions

KPV performed the experiments, analyzed data and wrote the paper. CL and RGE designed and coordinated the study, and evaluated the performance and laboratory measurements (microbial and hematological profiles, immunological results). ES and MK contributed with interpretation of the results and helped drafting the manuscript. RKP helped in laboratory setup and gene expression studies. AC participated in the design and coordination and helped with drafting the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The experiments were performed in accordance with requirements of the Danish Ministry of Justice regarding housing and treatment of experimental animals (Law 726, September 1993). The experimental protocols were approved by the local ethics commission for experimentation on animals (Aarhus University, Denmark) prior to the study.

Consent for publication

Not applicable

Competing interests

All authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Department of Veterinary and Animal Sciences, University of Copenhagen, Frederiksberg, Denmark
(2)
Department of Animal Science, Aarhus University, Tjele, Denmark
(3)
Department of Animal Nutrition and Biotechnology, Warsaw University of Life Sciences, Warsaw, Poland

References

  1. Modi CM, Mody SK, Patel HB, Dudhatra GB, Kumar A, Sheikh TJ. Growth promoting use of antimicrobial agents in animals. J Appl Pharm Sci. 2011;01(08):33–6.Google Scholar
  2. Hao H, Cheng G, Iqbal Z, Ai X, Hussain HI, Huang L, Dai M, Wang Y, Liu Z, Yuan Z. Benefits and risks of antimicrobial use in food-producing animals. Front Microbiol. 2014;5:288.View ArticlePubMedPubMed CentralGoogle Scholar
  3. Niewold TA. The non-antibiotic anti-inflammatory effect of antimicrobial growth promotors, the real mode of action? A hypothesis Poult Sci. 2007;86:605–9.View ArticlePubMedGoogle Scholar
  4. Asai T, Kojima A, Harada K, Ishihara K, Takahashi T, Tamura Y. Correlation between the usage volume of veterinary therapeutic antimicrobials and resistance in Escherichia coli isolated from the feces of food-producing animals in Japan. Jpn J Infect Dis. 2005;58(6):369–72.PubMedGoogle Scholar
  5. Bach Knudsen KE. The nutritional significance of “dietary fibre” analysis. Anim Feed Sci Tech. 2001;90(1–2):3–20.View ArticleGoogle Scholar
  6. Wiesner RS, Hendrixson DR, DiRita VJ. Natural transformation of Campylobacter jejuni requires components of a type II secretion system. J Bacterial. 2003;185(18):5408–18.View ArticleGoogle Scholar
  7. DANMAP 2013 report. Use of antimicrobial agents and occurrence of antimicrobial resistance in bacteria from food animals, food and humans in Denmark. http://www.danmap.org/downloads/reports.aspx. Accessed 6 Oct 2015.
  8. Van Immerseel F, De Buck J, Pasmans F, Huyghebaert G, Haesebrouck F, Ducatelle R. Clostridium perfringens in poultry an emerging threat for animal and public health. Avian Pathol. 2004;33(6):537–49.View ArticlePubMedGoogle Scholar
  9. Chang C. The immune effects of naturally occurring and synthetic nanoparticles. J Autoimmun. 2010;34(3):234–46.View ArticleGoogle Scholar
  10. Zhang Y, Bai Y, Yan B. Functionalized carbon nanotubes for potential medicinal applications. Drug Discov Today. 2010;15(11–12):428–35.View ArticlePubMedPubMed CentralGoogle Scholar
  11. Panacek A, Kvitek L, Prucek R, Kolar M, Vecerova R. Silver colloid nanoparticles: synthesis, characterization and their antibacterial activity. J Phys Chem B. 2006;110(33):16248–53.View ArticlePubMedGoogle Scholar
  12. Lok CN, Ho CM, Chen R, He QY, Yu WY, Sun H, Tam PK, Chiu JF, Che CM. Silver nanoparticles: partial oxidation and antibacterial activities. J Biol Inorg Chem. 2007;12(4):527–34.View ArticlePubMedGoogle Scholar
  13. Morones JR, Elechiguerra JL, Camacho A, Holt K, Kouri JB, Ramírez JT, Yacaman MJ. The bactericidal effect of silver nanoparticles. Nanotechnol. 2005;16(10):2346–53.View ArticleGoogle Scholar
  14. Kim JS, Kuk E, Yu KN, Kim JH, Park SJ, Lee HJ, Kim SH, Park YK, Park YH, Hwang CY, Kim YK, Lee YS, Jeong DH, Cho MH. Antimicrobial effects of silver nanoparticles. Nanomed. 2007;3(1):95–101.View ArticleGoogle Scholar
  15. Yoon K, Hoon Byeon J, Park J, Hwang J. Susceptibility constants of Escherichia coli and Bacillus subtilis to silver and copper nanoparticles. Sci Total Environ. 2007;373(2–3):572–5.View ArticlePubMedGoogle Scholar
  16. Ayala-Núñez NV, Lara Villegas HH, Ixtepan Turrent LC, Padilla CR. Silver nanoparticles toxicity and bactericidal effect against methicillin-resistant Staphylococcus aureus: nanoscale does matter. Nanobiotechnol. 2009;5:2–9.View ArticleGoogle Scholar
  17. Alt V, Bechert T, Steinrucke P, Wagener M, Seidel P, Dingeldein E, Domann E, Schnettler R. An in vitro assessment of the antibacterial properties and cytotoxicity of nanoparticulate silver bone cement. Biomaterials. 2004;25(18):4383–91.View ArticlePubMedGoogle Scholar
  18. Sawosz E, Chwalibog A, Mitura K, Mitura S, Szeliga J, Niemiec T, Rupiewicz M, Grodzik M, Sokolowska A. Visualization of morphological interaction of diamond and silver nanoparticles with Salmonella Enteritidis and Listeria Monocytogenes. J Nanosci Nanotechnol. 2011;11:1–7.View ArticleGoogle Scholar
  19. Chen D, Xi T, Bai J. Biological effects induced by nanosilver particles: in vivo study. Biomed Mater. 2007;2(3):126–8.View ArticleGoogle Scholar
  20. Rees JH, Gregson NA, Griffiths PL, Hughes RAC. Campylobacter jejuni and Guillain-Barré syndrome. Q J Med. 1993;86:623–34.View ArticlePubMedGoogle Scholar
  21. Nachamkin I. Microbiologic approaches for studying campylobacter in patients with Guillain-Barre syndrome. J Infect Dis. 1997;176(2):106–14.View ArticleGoogle Scholar
  22. Ketley JM. Pathogenesis of enteric infection by campylobacter. Microbiology. 1997;143(1):5–21.View ArticlePubMedGoogle Scholar
  23. Gormley FJ, Strachan NJ, Reay K, MacKenzie FM, Ogden ID, Dallas JF, Forbes KJ. Antimicrobial resistance profiles of campylobacter from humans, retail chicken meat, and cattle feces. Foodborne Pathog Dis. 2010;7(9):1129–31.View ArticlePubMedGoogle Scholar
  24. Sotiriou GA, Pratsinis SE. Antibacterial activity of nanosilver ions and particles. Environ Sci Technol. 2010;44(14):5649–54.View ArticlePubMedGoogle Scholar
  25. Dunn K, Edwards-Jones V. The role of Acticoat with nanocrystalline silver in the management of burns. Burns. 2004;30(Supp 1):S1–9.View ArticlePubMedGoogle Scholar
  26. Shrivastava S, Bera T, Roy A, Singh G, Ramachandrarao P, Dash D. Characterization of enhanced antibacterial effects of novel silver nanoparticles. Nanotechnol. 2007;18:225103.View ArticleGoogle Scholar
  27. Bhol KC, Schechter PJ. Topical nanocrystalline silver cream suppresses inflammatory cytokines and induces apoptosis of inflammatory cells in a murine model of allergic contact dermatitis. Br J Dermatol. 2005;152(6):1235–42.View ArticlePubMedGoogle Scholar
  28. Shin SH, Ye MK, Kim HS, Kang HS. The effects of nano-silver on the proliferation and cytokine expression by peripheral blood mononuclear cells. Int Immunopharmacol. 2007;7(13):1813–8.View ArticlePubMedGoogle Scholar
  29. Sawosz E, Binek M, Grodzik M, Zielinska M, Sysa P, Szmidt M, Niemiec T, Chwalibog A. Influence of hydrocolloidal silver nanoparticles on gastrointestinal microflora and morphology of enterocytes of quails. Arch Anim Nutr. 2007;61(6):441–51.View ArticleGoogle Scholar
  30. Sawosz E, Grodzik M, Zielinska M, Niemiec T, Olszanska B, Chwalibog A. Nanoparticles of silver do not affect growth, development and DNA oxidative damage in chicken embryos. Arch Geflügelk. 2009;73(3):S208–13.Google Scholar
  31. Greulich C, Kittler S, Epple M, Muhr G, Koller M. Studies on the biocompatibility and the interaction of silver nanoparticles with human mesenchymal stem cells (hMSCs). Langenbeck's Arch Surg. 2009;394(3):495–502.View ArticleGoogle Scholar
  32. Park EJ, Yi J, Kim Y, Choi K, Park K. Silver nanoparticles induce cytotoxicity by a Trojan-horse type mechanism. Toxicol in Vitro. 2010;24(3):872–8.View ArticlePubMedGoogle Scholar
  33. Nygaard UC, Hansen JS, Samuelsen M, Alberg T, Marioara CD, Løvik M. Single-walled and multi-walled carbon nanotubes promote allergic immune responses in mice. Toxicol Sci. 2009;109(1):113–23.View ArticlePubMedGoogle Scholar
  34. Mitchell LA, Lauer FT, Burchiel SW, McDonald JD. Mechanisms for how inhaled multi-walled carbon nanotubes suppress systemic immune function in mice. Nat Nanotechnol. 2009;4(7):451–6.View ArticlePubMedPubMed CentralGoogle Scholar
  35. Yamaguchi A, Fujitani T, Ohyama K, Nakae D, Hirose A, Nishimura T, Ogata A. Effects of sustained stimulation with multi-wall carbon nanotubes on immune and inflammatory responses in mice. J Toxicol Sci. 2012;37(1):177–89.View ArticlePubMedGoogle Scholar
  36. Wang X, Podila R, Shannahan JH, Rao AM, Brown JM. Intravenously delivered graphene nanosheets and multi-walled carbon nanotubes induce site specific Th2 inflammatory responses via the IL-33/ST2 axis. Int J Nanomedicine. 2013;8(3):1733–48.PubMedPubMed CentralGoogle Scholar
  37. Engberg RM, Hedemann MS, Leser TD, Jensen BB. Effect of zinc bacitracin and salinomycin on intestinal microflora and performance of broilers. Poult Sci. 2000;79(9):1311–9.View ArticlePubMedGoogle Scholar
  38. Pan D, Yu Z. Intestinal microbiome of poultry and its interaction with host and diet. Gut Microbes. 2014;5(1):108–19.View ArticlePubMedGoogle Scholar
  39. Knarreborg A, Simon MA, Engberg RM, Jensen BB, Tannock GW. Effects of dietary fat source and subtherapeutic levels of antibiotic on the bacterial community in the ileum of broiler chickens at various ages. Appl Environ Microbiol. 2002;68(12):5918–24.View ArticlePubMedPubMed CentralGoogle Scholar
  40. Chiao SH, Lin SH, Shen CI, Liao JW, Bau IJ, Wei JC, Tseng LP, Hsu SH, Lai PS, Lin SZ, Lin JJ, Su HL. Efficacy and safety of nanohybrids comprising silver nanoparticles and silicate clay for controlling salmonella infection. Int J Nanomedicine. 2012;7:2421–32.PubMedPubMed CentralGoogle Scholar
  41. Alemka A, Whelan S, Gough R, Clyne M, Gallagher ME, Carrington SD, Bourke B. Purified chicken intestinal mucin attenuates Campylobacter jejuni pathogenicity in vitro. J Med Microbiol. 2010;59:898–903.View ArticlePubMedGoogle Scholar
  42. Sondi I, Salopek-Sondi B. Silver nanoparticles as antimicrobial agent: a case study on E. Coli as a model for gram-negative bacteria. J Colloid Interface Sci. 2004;275(1):177–82.View ArticlePubMedGoogle Scholar
  43. Ahmadi F, Kurdestany AH. The impact of silver nano particles on growth performance, lymphoid organs and oxidative stress indicators in broiler chicks. Global Veterinaria. 2010;5(6):366–70.Google Scholar
  44. Asharani PV, Lian Wu Y, Gong Z, Valiyaveettil S. Toxicity of silver nanoparticles in zebrafish models. Nanotechnol. 2008;19(25):255102–10.View ArticleGoogle Scholar
  45. Grodzik M, Sawosz E. The influence of silver nanoparticles on chick embryo development and bursa of Fabricius morphology. J Anim Feed Sci. 2006;15(1):111–4.View ArticleGoogle Scholar
  46. Hillery AM, Jani PU, Florence AT. Comparative, quantitative study of lymphoid and non-lymphoid uptake of 60 nm polystyrene particles. J Drug Target. 1994;2(2):151–6.View ArticlePubMedGoogle Scholar
  47. Kim YS, Kim JS, Cho HS, Rha DS, Kim JM, Park JD, Choi BS, Lim R, Chang HK, Chung YH, Kwon IH, Jeong J, Han BS, Yu IJ. Twenty-eight-day oral toxicity, genotoxicity, and gender-related tissue distribution of silver nanoparticles in Sprague–Dawley rats. Inhal Toxicol. 2008;20(6):575–83.View ArticlePubMedGoogle Scholar
  48. Sarker N, Tsudzuki M, Nishibori M, Yasue H, Yamamoto Y. Cell-mediated and humoral immunity and phagocytic ability in chicken lines divergently elected for serum immunoglobulin M and G levels. Poult Sci. 2000;79(12):1705–9.View ArticlePubMedGoogle Scholar
  49. Pineda L, Chwalibog A, Sawosz E, Lauridsen C, Engberg R, Elnif J, Hotowy A, Sawosz F, Gao Y, Ali A, Moghaddam HS. Effect of silver nanoparticles on growth performance, metabolism and microbial profile of broiler chickens. Arch Anim Nutr. 2012;66(5):416–29.View ArticlePubMedGoogle Scholar
  50. Shang Y, Ren F, Song Z, Li Q, Zhou X, Wang X, Xu Z, Bao G, Wan T, Lei T, Wang N, Jiao XA, Huang J. Insights into campylobacter jejuni colonization and enteritis using a novel infant rabbit model. Sci Rep. 2016;6(28737):1–12. doi: 10.1038/srep28737.Google Scholar
  51. Zheng J, Meng J, Zhao S, Singh R, Song W. Campylobacter-induced interleukin-8 secretion in polarized human intestinal epithelial cells requires Campylobacter-secreted cytolethal distending toxin- and toll-like receptor-mediated activation of NFkappaB. Infect Immun. 2008;76:4498–508.View ArticlePubMedPubMed CentralGoogle Scholar
  52. Bhanja SK, Hotowy A, Mehra M, Sawosz E, Pineda L, Vadalasetty KP, Kurantowicz N, Chwalibog A. In ovo administration of silver nanoparticles and/or amino acids influence metabolism and immune gene expression in chicken embryos. Int J Mol Sci. 2015;16:9484–503.View ArticlePubMedPubMed CentralGoogle Scholar
  53. Sawosz E, Grodzik M, Lisowski P, Zwierzchowski L, Niemiec T, Zielińska M, Szmidt M, Chwalibog A. Influence of hydrocolloids of ag, au, and ag/cu alloy nanoparticles on the inflammatory state at transcriptional level. Bull Vet Inst Pulawy. 2010;54:81–5.Google Scholar
  54. Loghman A, Iraj SH, Naghi DA, Pejman M. Histopathology and apoptotic effect of nanosilver in liver of broiler chickens. Afr J Biotechnol. 2012;11(22):6207–11.Google Scholar
  55. Małaczewska J. The effect of silver nanoparticles on splenocyte activity and selected cytokine levels in the mouse serum at early stage of experimental endotoxemia. Pol J Vet Sci. 2011;14(4):597–604.PubMedGoogle Scholar
  56. Brown DM, Donaldson K, Borm PJ, Schins RP, Dehnhardt M, Gilmour P, Jimenez LA, Stone V. Calcium and ROS-mediated activation of transcription factors and TNF-alpha cytokine gene expression in macrophages exposed to ultrafine particles. Am J Physiol Lung Cell Mol Physiol. 2004;286(2):L344–53.View ArticlePubMedGoogle Scholar
  57. Su HL, Chou CC, Hung DJ, Lin SH, Pao IC, Lin JH, Huang FL, Dong RX, Lin JJ. The disruption of bacterial membrane integrity through ROS generation induced by nanohybrids of silver and clay. Biomaterials. 2009;30:5979–87.View ArticlePubMedGoogle Scholar
  58. Park EJ, Yoon J, Choi K, Yi J, Park K. Induction of chronic inflammation in mice treated with titanium dioxide nanoparticles by intratracheal instillation. Toxicology. 2009;260(1–3):37–46.View ArticlePubMedGoogle Scholar
  59. Carlson C, Hussain SM, Schrand AM, Braydich-Stolle LK, Hess KL, Jones RL, Schlager JJ. Unique cellular interaction of silver nanoparticles: size-dependent generation of reactive oxygen species. J Phys Chem B. 2008;112(43):13608–19.View ArticlePubMedGoogle Scholar
  60. Ahamed M, Karns M, Goodson M, Rowe J, Hussain SM, Schlager JJ, Hong Y. DNA damage response to different surface chemistry of silver nanoparticles in mammalian cell. Toxicol Appl Pharmacol. 2008;233(3):404–10.View ArticlePubMedGoogle Scholar
  61. Park S, Lee YK, Jung M, Kim KH, Eun-Kyung Ahn NC, Lim Y, Lee KH. Cellular toxicity of various inhalable metal nanoparticles on human alveolar epithelial cells. Inhal Toxicol. 2007;19(1):59–65.View ArticlePubMedGoogle Scholar
  62. Yen HJ, Hsu SH, Tsai CL. Cytotoxicity and immunological response of gold and silver nanoparticles of different sizes. Small. 2009;5(13):1553–61.View ArticlePubMedGoogle Scholar
  63. Vandebriel RJ, Tonk EC, de la Fonteyne-Blankestijn LJ, Gremmer ER, Verharen HW, van der Ven LT, van Loveren H, de Jong WH. Immunotoxicity of silver nanoparticles in an intravenous 28-day repeated-dose toxicity study in rats. Part and Fibre Toxicol. 2014;11:21.View ArticleGoogle Scholar
  64. Ji JH, Jung JH, Kim SS, Yoon JU, Park JD, Choi BS, Chung YH, Kwon IH, Jeong J, Han BS, Shin JH, Sung JH, Song KS, Yu IJ. Twenty-eight-day inhalation toxicity study of silver nanoparticles in Sprague-Dawley rats. Inhal Toxicol. 2007;19(10):857–71.View ArticlePubMedGoogle Scholar
  65. Bhol KC, Schechter PJ. Effects of nanocrystalline silver (NPI 32101) in a rat model of ulcerative colitis. Dig Dis Sci. 2007;52(10):2732–42.View ArticlePubMedGoogle Scholar
  66. Sung JH, Ji JH, Park JD, Yoon JU, Kim DS, Jeon KS, Song MY, Jeong J, Han BS, Han JH, Chung YH, Chang HK, Lee JH, Cho MH, Kelman BJ, Yu IJ. Subchronic inhalation toxicity of silver nanoparticles. Toxicol Sci. 2009;108(2):452–61.View ArticlePubMedGoogle Scholar
  67. Trickler WJ, Lantz SM, Murdock RC, Schrand AM, Robinson BL, Newport GD, Schlager JJ, Oldenburg SJ, Paule MG, Slikker W, Hussain SM, Ali SF. Silver nanoparticles induced blood-brain barrier inflammation and increased permeability in primary rat brain microvessel endothelial cells. Toxicol Sci. 2010;118(1):160–70.View ArticlePubMedGoogle Scholar
  68. Park EJ, Bae E, Yi J, Kim Y, Choi K, Leed SH, Yoon J, Lee BC, Park K. Repeated-dose toxicity and inflammatory responses in mice by oral administration of silver nanoparticles. Environ Toxicol Pharmacol. 2010;30(2):162–8.View ArticlePubMedGoogle Scholar
  69. Chen X, Schluesener HJ. Nanosilver: a nanoproduct in medical application. Toxicol Lett. 2008;176(1):1–12.View ArticlePubMedGoogle Scholar
  70. Georgantzopoulou A, Serchi T, Cambier S, Leclercq CC, Renaut J, Shao J, Kruszewski M, Lentzen E, Grysan P, Eswara S, Audinot JN, Contal S, Ziebel J, Guignard C, Hoffmann L, Murk AJ, Gutleb AC. Effects of silver nanoparticles and ions on a co-culture model for the gastrointestinal epithelium. Part and Fibre Toxicol. 2016;13:9.View ArticleGoogle Scholar
  71. Nadworny PL, Wang JF, Tredget EE, Burrell RE. Anti-inflammatory activity of nanocrystalline silver-derived solutions in porcine contact dermatitis. J Inflamm. 2010;7(13):1–20.Google Scholar

Copyright

© The Author(s). 2017

Advertisement