Skip to main content

Table 2 Genes and primers used in the study

From: Influence of silver nanoparticles on growth and health of broiler chickens after infection with Campylobacter jejuni

RNA target gene Primer sequences(5′–3′) PCR Product Gene bank Assess. No
Annealing Temperature Amplicon (bp)
GAPDH     NM_204305.1
Forward TGCTGCCCAGAACATCAT 61 °C 199  
Reverse ATCAGCAGCAGCCTTCAC    
ACTB     NM_205518.1
Forward GTCCACCTTCCAGCAGATGT 60 °C 169  
Reverse ATAAAGCCATGCCAATCTCG    
NF-kB     M86930.1
Forward TTGCTGCTGGAGTTGATGTC 60 °C 167  
Reverse TTGCTGCTGGAGTTGATGTC    
TNF-α     NM_204267.1
Forward TTCAGATGAGTTGCCCTTCC 59 °C 150  
Reverse TCAGAGCATCAACGCAAAAG    
  1. GAPDH Glyceraldehyde-3-phosphate dehydrogenase, ACTB Actin beta, NF-kB nuclear factor kappa B, and TNF-α Tumor necrosis factor alpha