Open Access

Arginine supplementation modulates pig plasma lipids, but not hepatic fatty acids, depending on dietary protein level with or without leucine

  • Marta Sofia Morgado dos Santos Madeira1,
  • Eva Sofia Alves Rolo1,
  • Virgínia Maria Rico Pires1,
  • Cristina Maria Riscado Pereira Mateus Alfaia1,
  • Diogo Francisco Maurício Coelho1,
  • Paula Alexandra Antunes Brás Lopes1,
  • Susana Isabel Vargas Martins1,
  • Rui Manuel Amaro Pinto2 and
  • José António Mestre Prates1Email author
BMC Veterinary ResearchBMC series – open, inclusive and trusted201713:145

https://doi.org/10.1186/s12917-017-1063-y

Received: 16 October 2015

Accepted: 18 May 2017

Published: 30 May 2017

Abstract

Background

In the present study, the effect of arginine and leucine supplementation, and dietary protein level, were investigated in commercial crossbred pigs to clarify their individual or combined impact on plasma metabolites, hepatic fatty acid composition and mRNA levels of lipid sensitive factors. The experiment was conducted on fifty-four entire male pigs (Duroc × Pietrain × Large White × Landrace crossbred) from 59 to 92 kg of live weight. Each pig was randomly assigned to one of six experimental treatments (n = 9). The treatments followed a 2 × 3 factorial arrangement, providing two levels of arginine supplementation (0 vs. 1%) and three levels of basal diet (normal protein diet, NPD; reduced protein diet, RPD; reduced protein diet with 2% of leucine, RPDL).

Results

Significant interactions between arginine supplementation and protein level were observed across plasma lipids. While dietary arginine increased total lipids, total cholesterol, HDL-cholesterol, LDL-cholesterol, VLDL-cholesterol and triacylglycerols in NPD, the inverse effect was observed in RPD. Overall, dietary treatments had a minor impact on hepatic fatty acid composition. RPD increased 18:1c9 fatty acid while the combination of leucine and RPD reduced 18:0 fatty acid. Arginine supplementation increased the gene expression of FABP1, which contributes for triacylglycerols synthesis without affecting hepatic fatty acids content. RPD, with or without leucine addition, upregulated the lipogenic gene CEBPA but downregulated the fat oxidation gene LPIN1.

Conclusions

Arginine supplementation was responsible for a modulated effect on plasma lipids, which is dependent on dietary protein level. It consistently increased lipaemia in NPD, while reducing the correspondent metabolites in RPD. In contrast, arginine had no major impact, neither on hepatic fatty acids content nor on fatty acid composition. Likewise, leucine supplementation of RPD, regardless the presence of arginine, promoted no changes on total fatty acids in the liver. Ultimately, arginine, leucine and dietary protein reduction seem to be unrelated with fatty liver development.

Keywords

Arginine Leucine Low dietary protein Fatty acids Gene expression Liver Pig

Background

Pork is the most consumed meat in European Union countries [1]. Accordingly, swine research has been focused on the improvement of meat quality and growth performance parameters in the last decades. The genetic selection of commercial pig lines has reduced subcutaneous fat content while decreasing simultaneously the intramuscular fat (IMF) content. IMF is a key meat quality trait, and the sensory properties of pork are negatively affected when IMF drops below 2–2.5% [2]. Moreover, due to anatomic and physiologic similarities with humans, pig has been used as an excellent biomedical model to study a wide range of human health conditions [3], in particular concerning nutrient digestion, absorption and metabolism [4, 5].

Some feeding strategies based on dietary amino acid supplementation and reduced protein diets (RPD) have been suggested to improve fat partitioning in pigs [68], that is, to increase IMF content which contributes to improve pork sensory traits, such as tenderness and juiciness, without affecting backfat thickness. In addition, arginine is classified as a nonessential amino acid for healthy adults because it is synthesised in most mammals, including humans, pigs or rats [9, 10]. Arginine plays multiple physiological functions in animals, one of which is the ability to enhance lipolysis through the expression of key genes responsible for fatty acid oxidation in a tissue-specific manner [11, 12]. Recently, it has been reported that arginine supplementation reduces fat accumulation in white adipose tissue of obese models, such as humans [13], rats [14], sheep [15] and growing finishing pigs [16].

Moreover, the essential amino acid leucine plays a pivotal role in protein synthesis in the muscle [17]. Some studies suggested that diets with high levels of leucine can increase IMF content in finishing pigs [6]. In addition to the supplementation of dietary amino acids, arginine and leucine, the use of RPD for increasing IMF content in pigs, with less effect on subcutaneous fat deposition, has also been described [7]. Donato et al. [18] reported that leucine supplementation during caloric restriction in rats also results in more fat loss and improves protein synthesis in both liver and muscle. Nonetheless, the effect of arginine and leucine supplemented to low protein diets on hepatic fatty acid metabolism remains elusive.

An experiment with fifty-four commercial crossbred male pigs fed on normal and reduced protein diets, with or without arginine and leucine addition, was carried out to study the effect, individual or combined, of dietary protein level and amino acids supplementation on lipid metabolism of adipose tissue and skeletal muscle. We reported previously that dietary arginine supplementation does not have a significant effect on IMF content, but increased total fat in subcutaneous adipose tissue [19]. However, some studies with dietary supplementation [8, 20] found an increase in IMF content without changing pork quality. Thus, arginine might be involved in the differential regulation of some key lipogenic genes expression in pig’s muscle and subcutaneous adipose tissue [21]. RPD increased IMF content and total fat content in subcutaneous adipose tissue. Moreover, leucine supplementation on RPD does not seem to result in an additional increase of IMF and total fat in subcutaneous adipose tissue [22]. These results suggest that adipogenesis and lipogenesis might be differently regulated in pig’s longissimus lumborum muscle and subcutaneous adipose tissue [19]. In the present study, and following on the same animal trial [19], we hypothesised that dietary arginine supplementation, RPD and RPD with leucine promote hepatic lipogenesis in pigs. To test this hypothesis, we assessed the fatty acid content and composition, as well as the gene expression levels of essential lipogenic enzymes and associated transcription factors.

Results

The present study reports the additive effect of dietary arginine and reduced protein diets, with or without leucine supplementation, on hepatic fatty acid composition and transcriptional profile of key lipogenic enzymes and transcription factors, using commercial crossbred pigs. This experiment also produced results on pigs’ performance and carcass traits that are presented elsewhere [19]. In brief, low-protein diets decrease animal performance in lean pigs, while dietary arginine has no effect on growth parameters [22]. Moreover, dietary leucine on low-protein diets does not seem to play any additional effect on pig growth performance or pork quality traits.

Plasma metabolites

The biochemical profile in plasma is shown in Table 1. A significant interaction between arginine supplementation and protein level (P < 0.001) was consistently observed across plasma lipids. Total lipids increased with RPD but decreased with RPDL, and also increased with arginine supplementation but decreased with arginine combined with RPD or RPDL (P < 0.001). The same variations were found for triacylglycerols (P < 0.001). Total cholesterol, HDL-cholesterol and LDL-cholesterol increased with RPD and with arginine supplementation (P < 0.001). Also, the RPD in combination with arginine decreased total cholesterol (P < 0.001). In addition, HDL-cholesterol decreased with arginine in combination with RPD, but increased with leucine (P < 0.001). This change contrasts with LDL-cholesterol, which decreased with arginine combined with RPD and leucine (P < 0.001). VLDL-cholesterol increased with RPD, but decreased with RPDL (P < 0.001). Also, arginine supplementation increased VLDL-cholesterol, but in combination with RPD decreased its levels (P < 0.001), which in turn were increased with leucine (P < 0.001).
Table 1

Effect of dietary arginine, leucine and protein level on plasma metabolites of commercial crossbred pigs1 −3

 

Control

Arginine

Significance level

NPD

RPD

RPDL

NPD

RPD

RPDL

Arginine

Dietary protein level

Arg × Prot

Mean

SE

Mean

SE

Mean

SE

Mean

SE

Mean

SE

Mean

SE

NPD vs. RPD

NPD vs. RPDL

RPD vs. RPDL

Plasma lipids

 Total lipids (mg/L)

3691c

19

4177a

27

4040b

29

4114ab

23

3678c

27

3735c

24

<0.001

0.320

0.536

0.151

<0.001

 Triacylglycerols (mg/L)

398b

5.5

441a

11

291cd

18

421a

6.1

304d

8.3

329c

6.5

0.007

<0.001

<0.001

<0.001

<0.001

 Total Cholesterol (mg/L)

897c

8.7

1118ab

13.9

1124a

8.8

1097a

10.1

937b

12.9

953b

9.7

<0.001

0.013

<0.001

0.321

<0.001

 HDL-cholesterol (mg/L)

328d

9.4

405ab

5.5

417a

6.0

385c

6.0

335d

3.8

391bc

4.8

0.017

0.044

<0.001

<0.001

<0.001

 LDL-cholesterol (mg/L)

490c

10

601ab

27

649a

10

628a

11

541b

14

495c

6.5

0.049

0.496

0.194

0.946

<0.001

 VLDL-cholesterol (mg/L)

79.5b

1.09

88.2a

3.72

58.2cd

2.24

84.2a

1.22

60.9d

1.67

65.8c

1.31

0.007

<0.001

<0.001

<0.001

<0.001

Other plasma metabolites

 Glucose (mg/L)

1540a

28

1150c

20

1210bc

25

1160c

19

1170c

18

1230b

16

<0.001

<0.001

<0.001

0.007

<0.001

 Insulin (mU/L)

3.71

0.458

3.48

0.458

3.77

0.458

3.05

0.458

3.36

0.458

2.68

0.458

0.102

0.933

0.736

0.674

0.581

 HOMA-IR3

(mmol/l × μU/ml)

1.40

0.206

0.99

0.171

1.13

0.161

0.88

0.122

0.96

0.103

0.81

0.084

0.021

0.304

0.269

0.963

0.283

 Leptin (μg/L)

1.25

0.134

1.49

0.134

1.92

0.134

1.40

0.134

1.61

0.134

1.54

0.134

0.718

0.096

0.004

0.190

0.088

 Urea (mg/L)

234b

7.7

274a

9.4

217bc

7.8

222b

5.9

177d

5.3

200c

5.5

<0.001

0.705

0.006

0.025

<0.001

 Total protein (g/L)

71.3b

0.40

74.3a

0.57

67.7c

0.77

71.4b

0.32

66.7c

0.79

66.7c

0.19

0.612

0.134

0.297

0.040

<0.001

Plasma hepatic markers

 ALT (U/L)

47.3b

0.60

48.9b

0.54

42.9c

0.54

53.0a

1.49

40.7c

1.94

33.9d

1.80

0.001

0.001

<0.001

<0.001

<0.001

 AST (U/L)

57.4

1.25

48.8

0.64

36.1

1.73

53.0

1.19

42.4

1.79

36.5

1.92

0.007

<0.001

<0.001

<0.001

0.122

 GGT (U/L)

18.8d

0.43

26.7bc

1.82

29.5b

0.58

28.3bc

1.07

25.5c

1.38

42.4a

1.05

<0.001

0.059

<0.001

<0.001

<0.001

1 NPD normal protein diet, RPD reduced protein diet, RPDL reduced protein diet with leucine addition.

2 AST aspartate aminotransferase (EC 2.6.1.1), ALT alanine aminotransferase (EC 2.6.1.2), ALP alkaline phosphatase (EC 3.1.3.1), GGT gamma-glutamyltransferase (EC 2.3.2.13).

3HOMA-IR, insulin resistance index = [fasting plasma glucose] × [fasting plasma insulin] / 22.5.

(a-d) mean values within a row with unlike superscript letter were significantly different (P < 0.05)

A significant interaction between arginine and protein level was found for glucose (P < 0.001), urea (P < 0.001) and total protein (P < 0.001). Glucose decreased with RPD and arginine supplementation, but arginine with RPDL increased its value. Urea increased with RPD, but when combined with leucine decreased its value when compared to the RPD. Arginine supplementation increased urea levels in RPDL; the inverse effect was observed in RPD. Curiously, arginine has no effect in NPD. Total protein increased with RPD and decreased with RPDL. Arginine had no impact on total protein, but arginine on RPD decreased its values. Arginine decreased HOMA-IR (P = 0.021). For plasma hormones, only leptin increased with RPDL when compared to NPD (P = 0.004).

Regarding plasma hepatic markers, a significant interaction between arginine supplementation and protein level was found for ALT (P < 0.001) and GGT (P < 0.001). Arginine supplementation increased ALT and GGT in NPD. RPDL, as well as arginine, on RPD and RPDL decreased ALT. RPD, RPDL and RPDL with arginine supplementation increased GGT. RPD (P < 0.001), RPDL (P < 0.001) and arginine supplementation decreased AST (P = 0.007).

Total lipids and fatty acid composition in the liver

Lipid content and fatty acid composition determined in the liver are shown in Table 2. Dietary treatments had no impact on total fatty acid content (P > 0.05). The prevalent fatty acids found across dietary groups were 18:0 (26–29%), 16:0 (16–18%), 18:2n-6 (14–17%), 18:1c9 (13–16%) and 20:4n-6 (9–11% of total FAME). Arginine supplementation affected only 2 of the 24 fatty acids identified. The proportions of 15:0 (P = 0.002) and 20:0 (P = 0.035) were increased in pigs fed on dietary arginine. The 15:0 proportion decreased with RPDL when compared to NPD (P = 0.013) and RPD (P = 0.019). 18:0 decreased (P = 0.035) with RPDL when compared to NPD. The 18:1c9 proportion increased (P = 0.028) with RPD when compared to the NPD. Neither fatty acid partial sums nor ratios were affected by dietary treatments (P > 0.05).
Table 2

Effect of dietary arginine, leucine and protein level on total fatty acids and fatty acid composition in the liver of commercial crossbred pigs1−3

 

Control

 

Arginine

Significance level

 

NPD

RPD

RPDL

NPD

RPD

RPDL

Arginine

Dietary protein level

Arg × Prot

Mean

SE

Mean

SE

Mean

SE

Mean

SE

Mean

SE

Mean

SE

NPD vs. RPD

NPD vs. RPDL

RPD vs. RPDL

TFA

1.47

0.094

1.45

0.094

1.31

0.094

1.31

0.094

1.25

0.094

1.25

0.094

0.075

0.246

0.641

0.484

0.725

Fatty acid composition

 12:0

0.13

0.007

0.17

0.036

0.15

0.009

0.16

0.012

0.15

0.012

0.15

0.007

0.577

0.539

0.607

0.801

0.151

 14:0

0.29

0.034

0.35

0.034

0.38

0.034

0.31

0.034

0.35

0.034

0.33

0.034

0.677

0.096

0.098

0.992

0.546

 15:0

0.15

0.045

0.31

0.045

0.24

0.045

0.36

0.045

0.43

0.045

0.28

0.045

0.002

0.889

0.013

0.019

0.170

 16:0

16.2

0.631

17.0

0.631

18.3

0.631

17.1

0.631

17.0

0.631

16.9

0.631

0.696

0.141

0.588

0.347

0.214

 16:1c7

0.36

0.031

0.40

0.031

0.42

0.031

0.38

0.031

0.37

0.031

0.39

0.031

0.674

0.210

0.606

0.456

0.712

 16:1c9

0.55

0.064

0.61

0.064

0.67

0.064

0.50

0.064

0.62

0.064

0.58

0.064

0.408

0.132

0.159

0.918

0.743

 17:0

1.07

0.126

1.36

0.126

1.28

0.126

1.28

0.126

0.35

0.126

1.25

0.126

0.553

0.471

0.154

0.473

0.592

 17:1c9

0.20

0.021

0.19

0.021

0.19

0.021

0.16

0.021

0.18

0.021

0.18

0.021

0.227

0.790

0.709

0.915

0.860

 18:0

28.4

0.97

26.1

0.97

26.3

0.97

29.5

0.97

27.5

0.97

27.9

0.97

0.093

0.068

0.035

0.766

0.972

 18:1c9

13.6

0.86

15.0

0.86

16.1

0.86

13.7

0.86

14.3

0.86

15.0

0.86

0.443

0.028

0.241

0.289

0.810

 18:1c11

1.80

0.086

1.65

0.086

1.69

0.086

1.75

0.086

1.64

0.086

1.71

0.086

0.896

0.387

0.149

0.555

0.910

 18:2n-6

16.8

0.88

16.1

0.88

14.3

0.88

14.5

0.88

16.1

0.88

14.9

0.88

0.427

0.229

0.632

0.095

0.222

 18:3n-3

0.32

0.031

0.27

0.031

0.27

0.031

0.26

0.031

0.32

0.031

0.25

0.031

0.739

0.289

0.901

0.245

0.257

 20:0

0.067

0.005

0.061

0.005

0.062

0.005

0.079

0.005

0.068

0.005

0.070

0.005

0.035

0.191

0.104

0.741

0.843

 20:1c11

0.21

0.015

0.22

0.015

0.25

0.015

0.23

0.015

0.21

0.015

0.24

0.015

0.689

0.095

0.763

0.050

0.417

 20:2n-6

0.48

0.031

0.57

0.074

0.45

0.074

0.45

0.074

0.50

0.032

0.46

0.031

0.363

0.744

0.154

0.093

0.577

 20:3n-3

0.59

0.063

0.60

0.063

0.51

0.063

0.44

0.063

0.51

0.063

0.49

0.063

0.086

0.813

0.523

0.382

0.579

 20:3n-6

0.47

0.089

0.48

0.089

0.49

0.064

0.42

0.068

0.53

0.023

0.48

0.061

0.977

0.570

0.350

0.727

0.664

 20:4n-6

10.5

1.27

9.82

1.27

9.75

1.27

8.59

1.27

10.5

1.27

10.2

1.27

0.794

0.743

0.634

0.882

0.532

 20:5n-3

0.40

0.093

0.41

0.093

0.51

0.093

0.65

0.093

0.51

0.093

0.55

0.093

0.092

0.948

0.510

0.469

0.493

 22:0

0.52

0.103

0.48

0.103

0.56

0.103

0.74

0.103

0.57

0.103

0.62

0.103

0.158

0.712

0.309

0.514

0.682

 22:4n-6

0.67

0.139

0.67

0.139

0.83

0.139

0.64

0.139

0.65

0.139

0.70

0.139

0.580

0.426

0.981

0.440

0.899

 22:5n-3

1.07

0.185

1.03

0.185

1.00

0.185

0.79

0.185

1.05

0.185

0.96

0.185

0.526

0.785

0.558

0.753

0.696

 22:6n-3

0.74

0.120

0.59

0.120

0.46

0.120

0.60

0.120

0.54

0.120

0.56

0.120

0.783

0.180

0.384

0.631

0.611

 Others

3.66

0.197

4.76

0.882

3.98

0.258

5.69

1.215

3.15

0.252

3.95

0.246

0.808

0.294

0.361

0.981

0.097

Fatty acid partial sums

 SFA

47.1

1.41

46.1

1.41

47.6

1.41

49.8

1.41

47.8

1.41

47.8

1.41

0.205

0.612

0.302

0.596

0.675

 MUFA

16.7

1.02

18.1

1.02

19.3

1.02

16.7

1.02

17.4

1.02

18.2

1.02

0.449

0.051

0.326

0.316

0.857

 PUFA

32.1

2.24

30.6

2.24

28.6

2.24

27.4

2.24

31.2

2.24

29.6

2.24

0.577

0.769

0.609

0.422

0.368

n-6 PUFA

29.0

2.00

27.7

2.00

25.8

2.00

24.6

2.00

28.3

2.00

26.8

2.00

0.568

0.800

0.564

0.407

0.344

n-3 PUFA

3.12

0.257

2.90

0.257

2.75

0.257

2.75

0.257

2.94

0.257

2.81

0.257

0.678

0.557

0.966

0.586

0.644

Fatty acid ratios

 PUFA/SFA

0.69

0.068

0.69

0.068

0.61

0.068

0.56

0.068

0.67

0.068

0.63

0.068

0.464

0.910

0.447

0.383

0.511

n-6/n-3

9.55

0.52

9.65

0.52

9.55

0.26

9.03

0.34

9.64

0.18

9.56

0.12

0.526

0.454

0.357

0.726

0.738

1 NPD normal protein diet, RPD reduced protein diet, RPDL reduced protein diet with leucine addition.

2 TFA total fatty acids; SFA = 12:0 + 14:0 + 15:0 + 16:0 + 17:0 + 18:0 + 20:0 + 22:0; MUFA = 16:1c7 + 16:1c9 + 17:1c9 + 18:1c9 + 18:1c11 + 20:1c11; PUFA = 18:2n-6 + 18:3n-3 + 20:2n-6 + 20:3n-3 + 20:3n-6 + 20:4n-6 + 20:5n-3 + 22:4n-6 + 22:5n-3 + 22:6n-3; n-6 PUFA = 18:2n-6 + 20:2n-6 + 20:3n-6 + 20:4n-6 + 22:4n-6; n-3 PUFA = 18:3n-3 + 20:3n-3 + 20:5n-3 + 22:5n-3 + 22:6n-3.

3Total fatty acids are expressed as g/100 g liver; fatty acid composition is expressed as % total fatty acids.

Gene expression levels of lipogenic enzymes and transcription factors in the liver

The gene expression levels of essential enzymes and transcription factors responsible for lipid metabolism in the liver are presented in Fig. 1. A significant interaction between arginine supplementation and protein level was found for the mRNA levels of ChREBP (P = 0.007) and FADS1 (P = 0.037). In pigs fed on diets without arginine supplementation, RPD decreased ChREBP expression level (P = 0.007), and RPDL increased (P = 0.037) FADS1. RPD increased the expression levels of CEBPA (P = 0.001), when compared to NPD; also, RPDL increased CEBPA when compared to RPD (P = 0.019). mRNA levels of DGAT were increased in pigs fed on RPDL, relative to NPD (P = 0.022) and RPD (P = 0.037). The expression levels of LPIN1 were down-regulated in RPD (P = 0.021) and RPDL (P = 0.031), when compared to NPD. Arginine, regardless the level of protein in the diets, increased FABP1 (P = 0.007) mRNA levels. ACACA, APOA5, CPT1A, CRAT, FADS2, FASN, PLIN2, PPARA, SCD and SREBP1 expression levels were kept unchanged by dietary treatments (P > 0.05).
Fig. 1

Effect of dietary arginine, leucine and protein level on gene expression in the liver of commercial crossbred pigs: a acetyl-CoA carboxylase (ACACA), b Apolipoprotein A-V (APOA5), c CCAAT/enhancer binding protein alpha (CEBPA), d Carbohydrate response element binding protein (ChREBP), e Carnitine palmitoyltransferase 1A (CPT1A), f carnitine O-acetyltransferase (CRAT), g Diacylglycerol acyltransferase (DGAT), h Fatty acid binding protein 1 (FABP1), i Fatty acid desaturase 1 (FADS1), j fatty acid desaturase 2 (FADS2), k fatty acid synthase (FASN), l Lipin 1 (LPIN1), m Perilipin 2 (PLIN2), n Peroxisome proliferator-activated receptor alpha (PPARA), o Stearoyl-CoA desaturase (SCD), p Sterol regulatory element binding protein 1 (SREBP1). Con, control diet; NPD, normal protein diet; RPD, reduced protein diet; RPDL, reduced protein diet with leucine addition. Values are means, with standard error represented by vertical bars. a, b Mean values within a row with unlike letters were significantly different (P < 0.05). “Arg” and Arg × protein level mean significant effect of arginine or interaction between arginine and protein level, respectively

Correlation analysis

Pearson’s correlation coefficients between fatty acids and gene expression levels in the liver are shown in Table 3. The FADS1 gene was negatively correlated with 18:3n-3 (P < 0.01) and positively associated with 20:1c11 (P < 0.05). Likewise, FADS2 relative mRNA levels were negatively correlated with 18:2n-6 (P < 0.05), and positively correlated with 20:1c11 (P < 0.05). FASN gene was positively correlated with 20:3n-6 (P < 0.05) and SCD with 22:4n-6 (P < 0.05). DGAT expression levels were negatively correlated with 18:2n-6 (P < 0.01) and 20:2n-6 (P < 0.05). PLIN2 mRNA levels correlated positively with 16:1c7 (P < 0.05) and 18:3n-3 (P < 0.001). PPARA was negatively correlated with 20:3n-3 (P < 0.05). Finally, SREBP1 gene was positively correlated with 12:0 (P < 0.05) and 20:3n-6 (P < 0.01), and negatively with 18:1c11 (P < 0.05).
Table 3

Pearson’s correlation coefficients between the fatty acid composition and the relative gene expression levels in the liver from commercial crossbred pigs1−2

 

ACACA

APOA5

CEBPA

ChREBP

CPT1A

CRAT

DGAT

FABP1

FADS1

FADS2

FASN

LPIN1

PLIN2

PPARA

SCD

SREBP1

Fatty acids

 12:0

               

0.29*

 14:0

                

 15:0

                

 16:0

                

 16:1c7

            

0.30*

   

 16:1c9

                

 17:0

                

 17:1c9

                

 18:0

                

 18:1c9

                

 18:1c11

               

−0.29*

 18:2n-6

      

−0.35**

  

−0.29*

      

 18:3n-3

        

−0.29*

   

0.51***

   

 20:0

                

 20:1c11

        

0.27*

0.28*

      

 20:2n-6

      

−0.32*

         

 20:3n-3

             

−0.27*

  

 20:3n-6

          

0.31*

    

0.35**

 20:4n-6

                

 20:5n-3

                

 22:0

                

 22:4n-6

              

0.28*

 

 22:5n-3

                

 22:6n-3

                

1Statistical significance of Pearson correlation coefficients: *, P < 0.05; **, P < 0.01; ***, P < 0.001.

2Fatty acid contents expressed as μmol/g liver.

Discussion

In order to gain insights on the underlying molecular mechanisms that control hepatic lipid metabolism in pigs fed reduced protein diets with amino acids supplementation (arginine and leucine), the gene expression levels of essential lipogenic and lipolytic enzymes and associated transcription factors were evaluated. Furthermore, the effect of dietary arginine and leucine supplementation combined with protein level and molecular mechanisms responsible for fat partitioning between adipose tissue and muscle are available elsewhere [19]. Briefly, diets supplemented with arginine, either alone or in combination with the RPD or leucine, promoted, in contrast to longissimus lumborum muscle, a lipogenic effect on adipose tissue. In addition, an increase on IMF content of longissimus lumborum muscle was observed in pigs fed on low protein diets [19]. Dietary arginine had no effect on growth performance parameters (ADFI, ADG, and G:F), but when dietary protein level was reduced by 19%, ADG was negatively affected [22]. This is probably explained by the lysine reduction on these diets [23]. Results on pigs’ performance and feed efficiency are published in Madeira et al. [22]. Moreover, entire male pigs were used because these animals are leaner than gilts or castrated barrows, thus having low eating quality, and being the most used in the Portuguese swine industry.

Data presented here indicate that, in the liver, dietary treatments affected more plasma metabolites than fatty acid composition or the transcriptional profile of essential lipogenic and lipolytic enzymes and associated transcription factors. A significant interaction between arginine supplementation and protein level was consistently observed across all plasma lipids. Arginine supplementation in normal protein diet increased plasma lipids, in particular total lipids, total cholesterol, HDL-cholesterol, LDL-cholesterol, VLDL-cholesterol and triacylglycerols. Arginine and reduced protein diets increased individually total lipids but, when combined, a clear decrease in total lipids was observed, suggesting a synergistic effect of both variables. L-arginine has important roles in physiology and overall metabolism; hence, it is beneficial for nutrient metabolism, immune response and circulatory functions in animals and humans [8, 11, 24, 25]. Fatty acid binding protein one (FABP1) prevents lipotoxicity of free fatty acids and regulates fatty acid trafficking and partition [26]. Its mRNA expression level was increased with arginine supplementation, which can be related to the increase of total lipids in plasma. Our results indicate that dietary arginine increase concentrations of total lipids, VLDL-cholesterol and triacylglycerols in plasma, which could be associated with increased fat accretion in the carcass [22]. In contrast, Hu et al. [27] reported that arginine supplementation improved nutritional status and lean tissue mass, while beneficially reduced ammonia, free fatty acids, triacylglycerols, and cholesterol levels in the plasma, as well as white fat in the body. In line with Hu et al. [27] and contrasting to our own data, He et al. [28] reported that dietary arginine reduces VLDL-cholesterol, lipids and triacylglycerols concentrations in piglets. Also, Tan et al. [8] reported that 1% of arginine supplemented on diet fed to growing finishing pigs for 60 days reduced positively serum triacylglycerols by 20% and whole-body fat content by 11%, while increasing whole-body skeletal muscle content by 5.5%. The variations of total lipids in plasma and related metabolites support the notion that arginine and its products play an important role in the metabolism of energy substrates [11, 29]. Arginine stimulates the secretion of growth hormone and insulin in mammals, thus playing an important role on the regulation of protein metabolism [9, 30]. In our study, arginine supplementation did not affect plasma hormones, insulin and leptin. Fu et al. [25] reported that arginine increases fatty acid oxidation and glucose in insulin-sensitive tissues, thereby reducing accretion of fat in white adipose tissues. Nevertheless, in our study, arginine supplementation in NPD decreased glucose concentration in plasma. Diacylglycerol acyltransferase (DGAT) catalyses the final step in triacylglycerol biosynthesis by converting diacylglycerols and fatty acyl-CoA into triacylglycerols [31]. In our study, leucine increased DGAT mRNA expression level but decreased triacylglycerols content which stands out as an apparent contradiction. This remains to be elucidated. Moreover, apoliprotein A-V (APOA5) is a key regulator of plasma triacylglycerols and inhibits the production of VLDL-cholesterol, the major carrier of triacylglycerols [32]. Herein, the APOA5 mRNA expression was unaffected by dietary treatments.

Blat et al. [33] reported that pigs fed on high dietary protein levels relative to normal, had increased insulin levels and consequently, increased HOMA-IR values. Nonetheless, insulin resistance index was found within the normal physiological range accepted for pigs, i.e., below 2.4 [34], even if arginine supplementation decreased HOMA-IR. As being so, this is a finding that does not deserve further pathophysiological understanding. Insulin stimulates fatty acid synthesis which leads to triacylglycerols formation and storage [35]. Accordingly, hepatic total fatty acids tend to decrease with arginine supplementation. Also, arginine affected all plasma hepatic markers, ALT, AST and GGT, but once again, the values observed are within the reference ranges for pig (31–58 U/L for ALT, 32–84 U/L for AST and 10–52 U/L for GGT) [36].

Previous studies have shown that dietary supplementation with arginine reduces plasma concentrations of urea in pigs [37]. Contrarily, in our study, arginine supplementation kept unchanged the urea levels in plasma. It is known that arginine is an intermediate in the urea cycle [27]. Unexpectedly, low protein diets increased urea levels, although the values found are still within the reference range for pig, which is 100–300 mg/L [36], therefore suggesting unaffected renal function.

In our study, leucine supplementation did not affect total cholesterol and LDL-cholesterol, contrarily to results described by Zhang et al. [38]. Those authors [38] reported that leucine supplementation decreases glucose metabolism, reduces diet-induced insulin resistance and lowers plasma glucagon levels and hepatic glucose-6-phosphatase mRNA expression in rats. In our study, leucine supplementation increased plasma glucose in combination with arginine supplementation without affecting insulin.

Dietary treatments had no impact on total fatty acids in the liver, which partially concurs with similar mRNA levels found for stearoyl-CoA desaturase (SCD), one of the key lipogenic enzymes for fatty acid biosynthesis [39]. Together with subcutaneous fat, liver plays an important role in mediating fatty acid metabolism in pigs, mainly triacylglycerols synthesis [40, 41]. As previously reported, dietary arginine did not increase IMF in pigs but enhanced total fat in subcutaneous adipose tissue by 6% [19] in parallel with the up-regulation of the lipogenic enzyme SCD [19]. Our results indicate that mRNA expression level of FABP1 increased with arginine supplementation, although arginine only increased 15:0 and 20:0 saturated fatty acids in the liver. RPD, with or without leucine supplementation increased CCAAT/enchancer bonding protein alpha (CEBPA), that plays a key role in the regulation of adipogenesis and lipogenesis [42] and decreased Lipin 1 (LPIN1) mRNA expression levels, that is crucial for adipocyte differentiation, maintenance of mature adipocyte function, and lipogenesis [43, 44]. RPD activated lipogenic mRNA levels and increased IMF content by approximately 45–48% [19]; consequently, RPD up-regulated CEBPA in the liver. Likewise, the expression level of LPIN1 decreased because LPIN1 is a transcriptional coactivator that promotes fat oxidation and suppresses de novo lipogenesis [45]. However, RPD did not increase total fatty acids in the liver. This finding indicates that low protein diets do not seem to promote fatty liver, a pathophysiological state related to various metabolic disorders, such as obesity, insulin resistance and diabetes, and hyperlipidaemia [41, 46].

The reduction of dietary protein increased oleic acid (18:1c9) percentage and tended to increase MUFA proportions (P = 0.051) in the liver. This finding was not supported by SCD gene expression levels which, as already stated, were unchanged by RPD. SCD is a key enzyme for unsaturated fatty acids biosynthesis by catalysing the 9-cis desaturation of saturated fatty acyl-CoA [47]. Conversely, RPD decreased SFA and n-3 PUFA percentages in the muscle. Similarly to the liver, RPD enhanced MUFA proportions in subcutaneous adipose tissue, mainly at the expenses of 18:1c9 increase [19]. The restriction of dietary protein combined with leucine did not change fatty acid composition in liver and subcutaneous adipose tissue [19].

Conclusion

A significant interaction between arginine and protein level was determinant on results found for plasma lipids and hepatic markers. Data clearly indicated that the effect of supplemented arginine is dependent on dietary protein level. Specifically, arginine supplemented to a normal protein diet increased total lipids, total cholesterol, HDL-cholesterol, LDL-cholesterol, VLDL-cholesterol and triacylglycerols, but promoted no changes on total fatty acid content in the liver. Hence, arginine does not appear responsible for enhancing hepatic fatty acid deposition. In a similar manner, leucine supplementation and dietary protein reduction promoted no changes on hepatic fatty acid content. Once again, restriction of dietary protein does not seem accountable for hepatic fatty acid deposition. The lack of effect of arginine or dietary protein in the liver is probably directly related to the minor contribution of liver to lipid metabolism in the pig. Ultimately, arginine, leucine and dietary protein reduction do not seem to contribute for fatty liver onset, which is in opposition to the effects previously described in a companion paper for adipose tissue and skeletal muscle [19].

Methods

Animals and experimental diets

This experiment was performed at Unidade de Investigação em Produção Animal facilities (Instituto de Investigação Agrária e Veterinária, UIPA-INIAV). All procedures were reviewed by the Ethics Commission of CIISA/FMV and approved by the Animal Care Committee of the National Veterinary Authority (Direcção-Geral de Alimentação e Veterinária, Portugal), in compliance with European Union legislation (2010/63/EU Directive). The staff members responsible for animal experiments hold a certified licence for conducting experiments on live animals from the National Veterinary Authority. Fifty-four commercial crossbred (25% Duroc, 25% Pietrain, 25% Large White and 25% Landrace) entire male pigs were selected with an initial body weight of 58.9 ± 1.59 kg (mean ± standard deviation). Pigs were fed a standard concentrate diet from weaning until the beginning of the experiment. Afterward, pigs were grouped in three pens containing three pigs each with individual control of feed intake (n = 9) and randomly assigned to one of the six isoenergetic (14 MJ ME/kg) dietary treatments (isonitrogenous control or arginine treatment, and two protein levels with or without leucine addition). Dietary treatments were, as follows: 16.0% of crude protein (normal protein diet, NPD (based on NRC [48]); 13.0% of crude protein (reduced protein diet, RPD); and 13.0% of crude protein plus L-leucine to achieve 2% (reduced protein diet with leucine, RPDL). Arginine treatment and isonitrogenous control were obtained through supplementation of basal diets with 1.0% of L-arginine and 2.05% of L-alanine, respectively. Arginine or alanine was added to the basal diet at the expense of maize starch to obtain isoenergetic diets. The amino acids were obtained from Fh Diedrichs & Ludwig Post (Mannheim, Germany). During the experiment, pigs were fed individually twice a day and had access to water ad libitum. Feed offered and refusals were recorded daily in order to calculate feed intake. Pigs were weighed weekly, just before feeding, throughout the experiment.

Diets were analysed for dry matter by drying samples at 100 °C to a constant weight. Nitrogen content was determined by the Kjeldahl method [49] and crude protein was calculated as 6.25 × N. Crude fibre was determined by the procedure described by the Association of Official Analytical Chemists (AOAC) [49]. Samples were extracted with petroleum ether, using an automatic Soxhlet extractor (Gerhardt Analytical Systems, Königswinter, Germany) to determine crude fat. Ash and starch contents were quantified, according to the procedures described in AOAC [49] and Clegg [50], respectively. Gross energy in the feed was determined by adiabatic bomb calorimetry (Parr 1261, Parr Instrument Company, Moline, IL, USA). Fatty acid methyl esters (FAME) in feed samples were analysed by one-step extraction and transesterification, using heptadecaenoic acid (17:0) as internal standard [51]. Total amino acids were extracted from the feed according to the method described by AOAC [52] and quantified by HPLC (Agilent 1100, Agilent Technologies, Avondale, PA, USA), including lysine, according to Henderson et al. [53]. The ingredients, chemical composition, amino acid and fatty acid profiles of the experimental diets are presented in Table 4.
Table 4

Ingredients and chemical, amino acid and fatty acid compositions of experimental diets1−4

 

Control

Arginine

Diets

NPD

RPD

RPDL

NPD

RPD

RPDL

Ingredients (%)

 Maize

62.9

67.3

75.0

63.7

72.3

74.5

 Barley

10.0

15.0

8.00

10.0

10.0

10.0

 Soybean meal

18.9

10.9

9.60

16.3

7.80

7.2

 Sunflower meal

1.64

0.44

-

4.56

4.66

1.98

 Soybean oil

1.15

0.98

0.99

1.06

0.88

0.85

 Calcium carbonate

0.73

0.73

0.71

0.72

0.70

0.71

 Bi-calcium phosphate

1.21

1.32

1.38

1.22

1.35

1.39

 Sodium bicarbonate

0.11

0.01

-

0.14

0.06

0.07

 Salt

0.35

0.43

0.44

0.33

0.39

0.38

 L-Lys

0.30

0.12

0.17

0.34

0.17

0.21

 L-Met

0.06

-

-

0.06

-

-

 L-Thr

0.07

-

-

0.08

-

-

 L-Ala

2.05

2.05

2.05

-

-

-

 L-Arg

-

-

-

1.00

1.00

1.00

 L-Leu

-

0.17

1.14

-

0.17

1.17

 Vitamin-trace mineral premix

0.40

0.40

0.40

0.40

0.40

0.40

 Acid mixture

0.10

0.10

0.10

0.10

0.10

0.10

 Antioxidant mixture

0.005

0.005

0.005

0.005

0.005

0.005

Chemical composition (% diet)

 DM

87.5

87.7

87.8

87.7

87.7

87.9

 Crude protein

16.0

13.1

13.1

15.9

12.9

12.7

 Starch

38.3

42.6

42.5

38.5

42.5

43.1

 Crude fat

3.36

3.46

3.54

3.46

3.46

3.56

 Crude fibre

4.38

3.22

3.06

4.66

4.20

3.36

 Ash

3.88

3.78

3.78

4.16

3.98

3.80

 Ca

0.66

0.73

0.75

0.59

0.68

0.71

 P

0.49

0.51

0.52

0.51

0.52

0.52

 ME (MJ ME/kg)

13.8

14.1

14.3

13.9

14.1

14.3

Amino acid composition (% diet)

 Ala

3.13

3.25

3.52

0.16

0.51

0.33

 Arg

1.05

0.83

0.49

1.84

1.60

1.56

 Asp

0.49

0.35

0.31

0.45

0.38

0.30

 Glu

2.07

1.54

1.38

1.82

1.59

1.34

 Gly

0.43

0.35

0.41

0.63

0.43

0.41

 His

2.02

1.21

0.92

1.27

1.02

0.90

 Ile

0.45

0.32

0.38

0.50

0.35

0.35

 Leu

1.01

0.93

1.51

0.95

0.94

1.74

 Lys

0.84

0.47

0.45

0.70

0.43

0.43

 Met

0.02

0.04

0.07

0.06

0.18

0.10

 Phe

0.68

0.47

0.28

0.39

0.33

0.31

 Pro

0.83

0.79

0.61

0.85

0.96

0.89

 Ser

0.81

0.67

0.61

0.78

0.63

0.57

 Thr

0.17

0.10

0.12

0.20

0.19

0.18

 Tyr

0.31

0.20

0.18

0.24

0.17

0.13

 Val

0.70

0.56

0.44

0.57

0.47

0.45

Fatty acid composition (% total fatty acids)

 16:0

15.0

15.3

14.9

15.0

15.0

14.9

 18:0

2.72

2.47

2.65

2.58

2.43

2.38

 18:1c9

24.9

25.0

25.8

24.9

25.4

25.6

 18:1c11

1.05

0.97

0.98

1.01

0.95

0.94

 18:2n-6

53.0

53.1

52.8

53.2

53.4

53.3

 18:3n-3

3.32

3.10

2.85

3.22

2.77

2.77

1 NPD normal protein diet, RPD reduced protein diet, RPDL reduced protein diet with leucine addition;

2As-fed basis;

3 ME metabolisable energy;

4The list of fatty acids and amino acids presented contains most relevant and usually published.

Pigs slaughter and sampling

After 17–19 h fasting, pigs were slaughtered at an average body weight of 91.7 ± 1.61 kg at the INIAV experimental abattoir. After electrical stunning and exsanguination, blood was obtained from the jugular vein and collected into tubes containing heparin and centrifuged at 1500 g for 15 min to obtain plasma. Samples for gene expression analysis were collected from the middle lobe of the liver, rinsed with sterile RNAse-free cold saline solution, cut into small pieces (thickness of ~0.3 cm), stabilised in RNA Later® (Qiagen, Hilden, Germany) and kept at −80 °C. For determination of fatty acids, liver samples were vacuum packed and stored at −20 °C, until analysis.

Plasma metabolites

Total cholesterol, high-density lipoprotein cholesterol (HDL-cholesterol), low-density lipoprotein cholesterol (LDL-cholesterol), triacylglycerols (TAG), phospholipids, total protein, urea, glucose, aspartate aminotransferase (AST), alanine aminotransferase (ALT), gamma-glutamyltransferase (GGT) and alkaline phosphatase (ALP) were analysed through diagnostic kits (Roche Diagnostics, Mannheim, Germany), using a Modular Hitachi Analytical System (Roche Diagnostics). Very low-density lipoprotein cholesterol (VLDL-cholesterol) and total lipids were calculated by Friedewald et al. [54] and Covaci et al. [55] formulas, respectively. Insulin and leptin concentrations were determined through the Porcine Insulin RIA kit (PI-12 K, Linco Research, Millipore, MA, USA) and the Multi-Species Leptin RIA kit (XL-85 K, Linco Research), respectively. To calculate the degree of insulin resistance, it was used the homeostasis model assessment using the insulin resistance index (HOMA-IR): fasting plasma glucose (mmol/L) times fasting plasma insulin (mU/L) divided by 22.5 [56]. Low HOMA-IR values indicate high insulin sensitivity, while high HOMA-IR values indicate high insulin resistance [56].

Hepatic lipid extraction and fatty acid composition

Liver samples were lyophilised (−60 °C and 2.0 hPa), maintained exsiccated at RT, and analysed within 2 weeks. Total lipids were extracted in duplicate and gravimetrically measured, according to Folch et al. [57], using dichloromethane and methanol (2:1 v/v) as substitute of chloroform and methanol (2:1 v/v), as described by Carlson [58]. Fatty acids were converted to methyl esters (FAME) by a combined transesterification procedure using NaOH in anhydrous methanol (0.5 M), followed by HCl:methanol (1:1 v/v), at 50 °C during 30 and 10 min, respectively, according to Raes et al. [59] protocol. FAME were determined by gas chromatograph (HP6890A, Hewlett–Packard, PA, USA), equipped with a flame ionization detector (FID) and a capillary column (CP-Sil 88; 100 m × 0.25 mm i.d., 0.20 μm film thickness; Chrompack, Varian Inc., Walnut Creek, CA, USA), asin Alves and Bessa [60]. The quantification of total FAME was carried out using nonadecanoic acid methyl ester (19:0) as the internal standard and by the conversion of relative peak areas into weight percentages. Fatty acids were identified by their retention times, corresponding to their standards from Supelco Inc. (Bellefonte, PA, USA). Fatty acids were expressed as g/100 g of total fatty acids.

RNA isolation and cDNA synthesis

A modified protocol combining Trizol (Invitrogen, CA, UK) and RNeasy Mini kit (Qiagen, Hilden, Germany) was used to isolate and purify total RNA from the liver. RNA samples were treated with DNAse I (Qiagen), prior to RT-qPCR. All procedures were performed according to manufacturer’s instructions. RNA was quantified using a NanoDrop ND-2000c spectrophotometer (Nanodrop, Thermo Fisher Scientific, Willmington, DE, USA). A260/280 ratios were between 1.9 and 2.1. A High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA) performed the reverse transcription. In brief, each 20 μL RT reaction containing 1 μg of DNase-treated total RNA template, 50 nM random RT Primer, 1× RT buffer, 0.25 mM of each dNTP, 3.33 U/μL multiscribe reverse transcriptase and 0.25 U/μL RNase inhibitor, and it was submitted to 25 °C for 10 min, 37 °C for 120 min and 85 °C for 5 min. The cDNA obtained was divided into aliquots and stored at −20 °C, until analysis.

Real-time quantitative PCR (RT-qPCR)

Gene specific intron-spanning primers were designed using Primer3 (http://bioinfo.ut.ee/primer3-0.4.0/) and Primer Express Software v. 2.0 (Applied Biosystems, Foster City, CA, USA) based on Sus scrofa species sequences (www.ncbi.nlm.nih.gov). Primers were acquired from NZYTech (Lisbon, Portugal). Sequence homology searches against the database of GenBank confirmed that these primers matched only the sequence for which they were designed. The amplicon length ranged between 67 and 166 bp, to ensure optimal DNA polymerization efficiency. In order to test the primers and verify the amplified products, a conventional PCR was performed for all genes, before qPCR experiments. PCR products were sequenced and homology searches were carried out with Blast (www.ncbi.nlm.nih.gov/blast), in order to confirm the identity of amplified fragments. Aiming to find the most stable endogenous control for the liver, five frequently used housekeeping genes, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 60S ribosomal protein L27 (RPL27), ornithine decarboxylase antizyme 1 (OAZ1), ribosomal protein large P0 (RPLP0) and 40S ribosomal protein S29 (RPS29) were applied to normalise the results of target genes. The geNorm [61] and NormFinder [62] software packages were used to analyse the expression level stability of housekeeping genes, as described in their manuals. The RPLP0 and RPL27 genes were chosen as the most stable internal controls pair for normalization. The sequence of primers, GenBank accession numbers, and product sizes are detailed in Table 5. The StepOnePlus PCR System software (Applied Biosystems) was used to calculate the PCR efficiency for each amplicon, by amplifying 5-fold serial dilutions of pooled cDNA and run in triplicate. All primer sets showed an efficiency between 90 and 110% and correlation coefficients were higher than 0.99. qPCR reactions were performed using MicroAmp Optical 96-well plates (Applied Biosystems) in a StepOnePlus thermocycler (Applied Biosystems) with standard cycling conditions. The 12.5 μl PCR reaction mixture included 6.25 μl of 2× Power SYBR Green PCR Master Mix (Applied Biosystems), 160 nM of forward and reverse primers, and 2 μl of diluted cDNA as template. No transcription and template samples were used as controls. The primer specificity and formation of primer-dimers were checked by melting curve analysis and agarose gel electrophoresis. All analyses were carried out in duplicate, and relative amounts for each target gene were calculated using the geometric mean of RPLP0/RPL27 as normaliser. The relative expression levels were calculated as a variation of the Livak method [63], corrected for variation in amplification efficiency, as described by Fleige et al. [64].
Table 5

Characterization of the select genes used in real time quantitative PCR1−2

Gene symbol

Full gene name

GenBank accession number

Forward primer

Reverse primer

Product size (bp)

ACACA

Acetyl-CoA carboxylase alpha

NM_001114269.1

ggccatcaaggacttcaacc

acgatgtaagcgccgaactt

120

APOA5

Apolipoprotein A-V

NM_001159308.1

agggaaaggcttctgggacta

tgtctttcagtctcgtgggctc

107

CEBPA

CCAAT/enhancer binding protein (C/EBP) alpha

XM_003127015.2

ggccagcacacacacattaga

cccccaaagaagagaaccaag

71

ChREBP

Carbohydrate response element binding protein

XM_003481002.2

tgacatgatccagcctgacc

gggggctcagagaagtttga

126

CPT1A

Carnitine palmitoyltransferase 1A

NM_001129805.1

cgattatccaccagccagac

caccccataaccatcgtcag

120

CRAT

Carnitine O-acetyltransferase

NM_001113047.1

ggcccaccgagcctacac

atggcgatggcgtaggag

138

DGAT

Diacylglycerol acyltransferase

NM_214051.1

caactaccgtggcatcctga

tagaaacagccgtgcattgc

67

FABP1

Fatty acid binding protein 1

NM_001004046.1

aacttctccggcaaataccaa

attctgcacgatttccgatg

129

FADS1

Fatty acid desaturase 1

NM_001113041.1

gtgggtggacttggcctg

gatgtgcatggggatgtggt

166

FADS2

Fatty acid desaturase 2

NM_001171750.1

gccttacaaccaccagcatga

aggccaagtccacccagtc

122

FASN

Fatty acid synthase

NM_001099930.1

acaccttcgtgctggcctac

atgtcggtgaactgctgcac

112

LPIN1

Lipin 1

NM_001130734.1

aagtcgccgccctgtatttc

ttgtcgctggcctgttttgt

67

PLIN2

Perilipin 2

NM_214200.2

catgtccggtgctctcccta

cccagtcacagcccctttag

160

PPARA

Peroxisome proliferator-activated receptor alpha

NM_001044526.1

tttccctctttgtggctgct

ggggtggttggtctgcaag

128

SCD

Stearoyl-CoA desaturase

NM_213781.1

agccgagaagctggtgatgt

gaagaaaggtggcgacgaac

140

SREBP1

Sterol regulatory element binding protein 1

NM_214157.1

gtgctggcggaggtctatgt

aggaagaagcgggtcagaaag

86

RPLP0 2

Ribosomal phosphoprotein large P0 subunit

NM_001098598.1

tccaggctttaggcatcacc

ggctcccactttgtctccag

95

RPL27 2

Ribosomal protein L27

NM_001097479.1

gtactccgtggatatccccttg

aacttgaccttggcctctcga

102

1Entrez Gene, National Center for Biotechnology Information (NCBI)

2housekeeping gene

Statistics

Data were checked for normal distribution and variance homogeneity. As variance heterogeneity was found for the majority of plasma metabolites, fatty acids and genes, these data were analysed using the MIXED procedure in Statistical Analysis Systems software package, version 9.2 (SAS Institute, Cary, NC, USA). The experimental unit was the animal. The model included as fixed effects dietary arginine and the basal diet (protein level with or without leucine supplementation) and their respective interaction, and the REPEATED statement considering the group option to accommodate variance heterogeneity. If the interaction between dietary arginine and protein level was significant, multiple comparisons of least-square means were determined using the PDIFF with Tukey-Kramer adjustment options of SAS. The contrasts between dietary protein level and leucine (NPD vs. RPD, NPD vs. RPDL, and RPD vs. RPDL) were performed. Pearson correlation matrices were computed using the PROC CORR of SAS. The level of significance was set at P < 0.05.

Abbreviations

ACACA

Acetyl-CoA carboxylase

APOA5

Apolipoprotein A-V

CEBPA

CCAAT/enhancer binding protein alpha

ChREBP

Carbohydrate response element binding protein

CPT1A

Carnitine palmitoyltransferase 1A

CRAT

Carnitine O-acetyltransferase

DGAT

Diacylglycerol O-acyltransferase

FABP1

Fatty acid binding protein 1

FADS1

Fatty acid desaturase 1

FADS2

Fatty acid desaturase 2

FAME

Fatty acid methyl esters

FASN

Fatty acid synthase

GAPDH

Glyceraldehyde-3-phosphate dehydrogenase

LPIN1

Lipin 1

MUFA

Monounsaturated fatty acids

OAZ1

Ornithine decarboxylase antizyme 1

PLIN2

Perilipin 2

PPARA

Peroxisome proliferator-activated receptor alpha

PUFA

Polyunsaturated fatty acids

RPD: 

Reduced protein diet

RPDL: 

Reduced protein diet with leucine supplementation

RPLP0

Ribosomal protein large P0

RPS29

40S ribosomal protein S29

SCD

Stearoyl-CoA desaturase

SFA

Saturated fatty acids

SREBP1

Sterol regulatory element binding protein 1

Declarations

Acknowledgements

The authors are thankful to Clínica Médica e Diagnóstico Dr. Joaquim Chaves (Algés, Portugal). We ackowledge Eng. J. Santos Silva and Eng. António Sequeira (Unidade de Investigação em Produção Animal, INIAV) for technical assistance and also, Dr. Shabir Najmudin for revising the manuscript.

Funding

Financial support from Fundação para a Ciência e a Tecnologia (PTDC/CVT/99210/2008), CIISA project (UID/CVT/00276/2013) and individual fellowships to MSMSM (SFRH/BPD/97432/2013) and to SIVM (SFRH/BPD/63019/2009). VMRP is an assistant researcher supported through an IF-FCT contract (2013 FCT investigator). PAABL is a researcher from the FCT program “Ciência 2008” and Incentivo 2014 project (AGR/UI0276/2014).

Availability of data and materials

The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors’ contributions

MSMSM, ESAR, VMRP, SIVM, DFMC, PAABL and RMAP performed tissue sampling and laboratory work. MSMSM was responsible for statistical analysis. MSMSM, CMRPMA, PAABL and JAMP were responsible for interpretation of results and preparation of the manuscript. JAMP was responsible for the study design. All authors read and approved the findings of the study.

Competing interests

The authors declare that they have no competing interests.

Consent for publication

Not applicable.

Ethics approval and consent to participate

All procedures involving animals were approved by the Animal Care Committee of the National Veterinary Authority (Direcção-Geral de Alimentação e Veterinária, Portugal), following the appropriated European Union guidelines (2010/63/EU Directive) and reviewed by the Ethics Commission of CIISA/FMV. All staff members responsible for animal experiments hold a certified licence for conducting experiments on live animals from the National Veterinary Authority.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
CIISA, Faculdade de Medicina Veterinária, Universidade de Lisboa
(2)
iMed.UL, Faculdade de Farmácia, Universidade de Lisboa

References

  1. Eurostat. Production of meat. 2015. http://epp.eurostat.ec.europa.eu/. Accessed 1 Oct 2015.
  2. De Vol DL, McKeith FK, Bechtel PJ, Novakofski J, Shanks RD, Carr TR. Variations in composition and palatability traits and relationships between muscle: characteristics and palatability in a random sample of pork carcasses. J Anim Sci. 1988;66:385–95.View ArticleGoogle Scholar
  3. Sullivan TP, Eaglstein WH, Davis SC, Mertz P. The pig as a model for human wound healing. Wound Repair Regen. 2001;9:66–76.View ArticlePubMedGoogle Scholar
  4. Burrin DG, Ng K, Stoll B, Sáenz De Pipaón M. Impact of newgeneration lipid emulsions on cellular mechanisms of parenteral nutrition-associated live disease. Adv Nutr. 2014;5:82–91.View ArticlePubMedPubMed CentralGoogle Scholar
  5. Suryawan A, Davis TA. Regulation of protein degradation pathways by amino acids and insulin in skeletal muscle of neonatal pigs. J Anim Sci Biotechnol. 2014;5:8.View ArticlePubMedPubMed CentralGoogle Scholar
  6. Hyun Y, Ellis M, McKeith FK, Baker DH. Effect of dietary leucine level on growth performance, and carcass and meat quality in finishing pigs. Can J Anim Sci. 2003;83:315–8.View ArticleGoogle Scholar
  7. Doran O, Moule SK, Teye GA, Whittington FM, Hallet KG, Wood JD. A reduced protein diet induces steroyl-CoA desaturase protein expression in pig muscle but not in subcutaneous adipose tissue: relationship with intramuscular lipid formation. Br J Nutr. 2006;95:609–17.View ArticlePubMedGoogle Scholar
  8. Tan BE, Yin YL, Liu ZQ, Li X, Xu H, Kong X, et al. Dietary L-Arginine supplementation increases muscle gain and reduced body fat mass in growing-finishing pigs. Amino Acids. 2009;37:169–75.Google Scholar
  9. Flynn NE, Meininger CJ, Haynes TE, Wu G. The metabolic basis of arginine nutrition and pharmacotherapy. Biomed Pharmacother. 2002;56:427–38.View ArticlePubMedGoogle Scholar
  10. Wu G, Bazer FW, Davis TA, Kim SW, Li P, Rhoads JM, et al. Arginine metabolism and nutrition in growth, health and disease. Amino Acids. 2009;37:153–68.Google Scholar
  11. Jobgen WS, Fried SK, Fu WJ, Meininger CJ, Wu G. Regulatory role for the arginine-nitric oxide pathway in metabolism of energy substrates. J Nutr Biochem. 2006;17:571–88.View ArticlePubMedGoogle Scholar
  12. Tan B, Yin Y, Liu Z, Tang W, Xu H, Kong X, et al. Dietary L-arginine supplementation differentially regulates expression of lipid-metabolic genes in porcine adipose tissue and skeletal muscle. J Nutr Biochem. 2011;22:441–5.Google Scholar
  13. Hurt RT, Ebbert JO, Schroeder DR, Croghan IT, Bauer BA, McClave SA, et al. Arginine for the treatment of centrally obese subjects: a pilot study. J Diet Suppl. 2014;11:40–52.Google Scholar
  14. Jobgen WJ, Meininger CJ, Jobgen SC, Li P, Lee M-J, Smith SB, et al. Dietary l-arginine supplementation reduces white-fat gain and enhances skeletal muscle and brown fat masses in diet-induced obese rats. J Nutr. 2009;139:230–7.Google Scholar
  15. Satterfield MC, Dunlap KA, Keisler DH, Bazer FW, Wu G. Arginine nutrition and fetal brown adipose tissue development in diet-induced obese sheep. Amino Acids. 2014;43:1593–603.View ArticleGoogle Scholar
  16. Tan BE, Li XG, Yin YL, Wu ZL, Liu C, Tekwe CD, et al. Regulatory roles for l-arginine in reducing white adipose tissue. Front Biosci. 2012;17:2237–46.Google Scholar
  17. Hyun Y, Kim JD, Ellis M, Peterson BA, Baker DH, McKeith FK. Effect of dietary leucine and lysine levels on intramuscular fat content in finishing pigs. Can J Anim Sci. 2007;87:303–6.View ArticleGoogle Scholar
  18. Donato JJ, Pedrosa RG, Cruzat VF, Pires IS, Tirapegui J. Effects of leucine supplementation on the body composition and protein status of rats submitted to food restriction. Nutrition. 2006;22:520–7.View ArticlePubMedGoogle Scholar
  19. Madeira MS, Pires VMR, Alfaia CM, Luxton R, Doran O, Bessa RJB, et al. Combined effects of dietary arginine, leucine and protein levels on fatty acid composition and gene expression in the muscle and subcutaneous adipose tissue of crossbred pigs. Br J Nutr. 2014;111:1521–35.Google Scholar
  20. Ma X, Lin Y, Jiang Z, Zheng C, Zhou G, Yu D, et al. Dietary arginine supplementation enhances antioxidative capacity and improves meat quality of finishing pigs. Amino Acids. 2010;38:95–102.Google Scholar
  21. Go G, Wu G, Silvey DT, Choi S, Li X, Smith SB. Lipid metabolism in pigs fed supplemental conjugated linoleic acid and/or dietary arginine. Amino Acids. 2012;43:1713–26.View ArticlePubMedGoogle Scholar
  22. Madeira MS, Alfaia AM, Costa P, Lopes PA, Lemos JPC, Bessa RJB, et al. The combination of arginine and leucine supplementation of reduced crude protein diets for boars increase eating quality of pork. J Anim Sci. 2014;92:2030–40.Google Scholar
  23. Madeira MS, Costa P, Alfaia CM, Lopes PA, Bessa RJB, Lemos JPC, et al. The increased intramuscular fat promoted by dietary lysine restriction in lean but not in fatty pig genotypes improves pork sensory attributes. J Anim Sci. 2013;91:3177–87.Google Scholar
  24. Hoang HH, Padgham SV, Meininger CJ. L-Arginine, tetrahydrobiopterin, nitric oxide and diabetes. Curr Opin Clin Nutr Metab Care. 2013;16:76–82.View ArticlePubMedGoogle Scholar
  25. Fu W, Haynes TE, Kohli R, Hu J, Shi W, Spencer TE, et al. Dietary supplementation with L-arginine reduces fat mass in Zucker diabetic fatty rats. J Nutr. 2005;135:714–21.Google Scholar
  26. Guzman C, Benet M, Pisonero-Vaquero S, Moya M, García-Mediavilla V, Martínez-Chantar ML, et al. The human liver fatty acid binding protein (FABP1) gene is activated by FOXA1 and PPARα; and repressed by C7EBPα: implications in FABP1 down-regulation in non-alcoholic fatty liver disease. Biochim Biophys Acta Mol Cell Biol Lipids. 2013;4:803–18.Google Scholar
  27. Hu S, Li X, Rezaei R, Meininger CJ, McNeal CJ, Wu G. Safety of long-term dietary supplementation with L-arginine in pigs. Amino Acids. 2015;47:925–36.View ArticlePubMedGoogle Scholar
  28. He Q, Kong X, Wu G, Ren P, Tang H, Hao F, et al. Metabolomic analysis of the response of growing pigs to dietary L-arginine supplementation. Amino Acids. 2009;37:199–208.Google Scholar
  29. Montanez R, Rodriguez-Caso C, Sanchez-Jimenez F, Medina MA. In silico analysis of arginine catabolism as a source of nitric oxide or polyamines in endothelial cells. Amino Acids. 2008;34:223–9.View ArticlePubMedGoogle Scholar
  30. Grimble GK. Adverse gastrointestinal effects of arginine and related amino acids. J Nutr. 2007;137:1693–701.Google Scholar
  31. Wang Y, Xu HY, Zhu Q. Progress in the study on mammalian diacylglycerol acyltransgrease (DGAT) gene and its biological function. Hereditas. 2007;29:1167–72.View ArticlePubMedGoogle Scholar
  32. Garelnabi M, Lor K, Jin J, Chai F, Santanam N. The paradox of ApoA5 modulation of triglycerides: evidence form clinical and basic research. Clin Biochem. 2013;46:12–9.View ArticlePubMedGoogle Scholar
  33. Blat S, Morise A, Sauret A, Louveau I, Macé K, Le Huerou-Luron I, et al. The protein level of isoenergetic formulae does not modulate postprandial insulin secretion in piglets and has no consequences on later glucose tolerance. Br J Nutr. 2012;108:102–12.Google Scholar
  34. Wilcox G. Insulin and insulin resistance. Clin Biochem Rev. 2005;26:19–39.PubMedPubMed CentralGoogle Scholar
  35. Bergen WG, Mersmann HJ. Comparative aspects of lipid metabolism: impact on contemporary research and use of animal models. J Nutr. 2005;135:2499–502.PubMedGoogle Scholar
  36. Jackson PGG, Cockcroft PD. Appendix 3, laboratory reference values: biochemistry. Clini Exam Farm Anim. 2002:303–5.Google Scholar
  37. Mao XB, Qi S, Yu B, Huang ZQ, Chen H, Mao Q, et al. Dietary L-arginine supplementation enhances porcine beta-defensins gene expression in some tissues of weaned pigs. Lives Sci. 2012;148:103–8.Google Scholar
  38. Zhang Y, Guo K, LeBlanc RE, Loh D, Schwartz GJ, Yu Y. Increasing dietary leucine intake reduces diet-induced obesity and improves glucose and cholesterol metabolism in mice via multimechanisms. Diabetes. 2007;56:1647–54.View ArticlePubMedGoogle Scholar
  39. Nakamura MT, Nara TY. Structure, function, and dietary regulation of delta6, delta5, and delta9 desaturases. Annu Rev Nutr. 2004;24:345–76.View ArticlePubMedGoogle Scholar
  40. Dodson MV, Hausman GJ, Guan L, Du M, Rasmussen TP, Poulos SP, et al. Lipid metabolism, adipocyte depot physiology and utilization of meat animals as experimental models for metabolic research. Int J Biol Sci. 2010;6:691–9.Google Scholar
  41. Lim S, Oh TJ, Koh KK. Mechanisms link between nonalcoholic fatty liver disease and cardiometabolic disorders. Int J Card. 2015;201:408–14.View ArticleGoogle Scholar
  42. Zhao S, Wang J, Song X, Zhang X, Ge C, Gao S. Impact of dietary protein on lipid metabolism-related gene expression in porcine adipose tissue. Nutr Metab. 2010;7:6.View ArticleGoogle Scholar
  43. Suviolahti E, Reue K, Cantor RM, Phan J, Gentile M, Naukkarinen J, et al. Cross-species analyses implicate lipin 1 involvement in human glucose metabolism. Hum Mol Genet. 2006;15:377–86.Google Scholar
  44. Wiedmann S, Fischer M, Koehler M, Neureuther K, Riegger G, Doering A, et al. Genetic variants within the LPIN1 gene, encoding lipin, are influencing phenotypes of the metabolic syndrome in humans. Diabetes. 2008;57:209–17.Google Scholar
  45. Harris TE, Finck BN. Dual function lipin porteins and glycerolipid metabolism. Trends Endocrinol Metab. 2011;22:121–4.View ArticleGoogle Scholar
  46. Kirpich IA, Marsano LS, McClain CJ. Gut-liver axis, nutrition, and non-alcoholic fatty liver disease. Clin Biochem. 2015;48:923–30.View ArticlePubMedPubMed CentralGoogle Scholar
  47. Ntambi JM. Regulation of stearoyl-CoA desaturase by polyunsaturated fatty acids and cholesterol. J Lipid Res. 1999;40:1549–58.PubMedGoogle Scholar
  48. NRC. Nutrient Requirements for Swine. 10th ed. Washington, DC: National Academies Press; 1998.Google Scholar
  49. AOAC. Official methods of analysis. 17th ed. Arlington: Assoc. Offic. Anal. Chem; 2000.Google Scholar
  50. Clegg KM. The application of the anthrone reagent to the estimation of starch in cereals. J Sci Food Agric. 1956;70:40–4.View ArticleGoogle Scholar
  51. Sukhija PS, Palmquist DL. Rapid method for determination of total fatty acid content and composition of feedstuffs and feces. J Agric Food Chem. 1998;36:1202–6.View ArticleGoogle Scholar
  52. Association of Official Analytical Chemists. Amino acid analysis using Zorbax Eclipse-AAA columns and the Agilent 1100 HPLC. In: Official Methods of Analysis of the Association of Official Analytical Chemists International, GW Latimer and W Horwitz, editors. AOAC International.Gaithersburg, MD: 2005.18th ed. p. 473.Google Scholar
  53. Henderson JW, Ricker RD, Bidlingmeyer BA. Rapid, accurate, sensitive and reproducible analysis of amino acids. Agilent publication number 5980-1193EN. Palo Alto: Agilent Technologies; 2000.Google Scholar
  54. Friedewald WT, Levy RI, Fredrickson D. Estimation of the concentration of low-density lipoprotein cholesterol in plasma, without use of the preparative ultracentrifuge. Clin Chem. 1972;18:499–502.PubMedGoogle Scholar
  55. Covaci A, Voorspoels S, Thomsen C, et al. Evaluation of total lipids using enzymatic methods for the normalization of persistent organic pollutant levels in serum. Sci Total Environ. 2006;366:361-366.Google Scholar
  56. Matthews DR, Hosker JP, Rudenski AS, Naylor BA, Treacher DF, Turner RC. Homeostasis model assessment: insulin resistance and beta-cell function from fasting plasma glucose and insulin concentrations in man. Diabetologia. 1985;28:412–9.View ArticlePubMedGoogle Scholar
  57. Folch J, Lees M, Stanley GH. A simple method for the isolation and purification of total lipids from animal tissues. J Biol Chem. 1957;226:497–509.PubMedGoogle Scholar
  58. Carlson LA. Extraction of lipids from human whole serum and lipoproteins and from rat liver tissue with methylene chloride-methanol: a comparison with extraction chloroform-methanol. Clin Chim Acta. 1985;149:89–93.View ArticlePubMedGoogle Scholar
  59. Raes K, De Smet SD, Demeyer D. Effect of double-muscling in Belgian blue young bulls on the intramuscular fatty acid composition with emphasis on conjugated linoleic acid and polyunsaturated fatty acids. Anim Sci. 2001;73:253–60.View ArticleGoogle Scholar
  60. Alves SP, Bessa RJB. Comparison of two gas–liquid chromatograph columns for the analysis of fatty acids in ruminant meat. J Chromatogr. 2009;1216:5130–9.View ArticleGoogle Scholar
  61. Vandesompele J, De Preter K, Pattyn F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002;3:7.View ArticleGoogle Scholar
  62. Andersen CL, Jensen JL, Orntoft TF. Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 2004;64:5245–50.View ArticlePubMedGoogle Scholar
  63. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta C (T)) method. Methods. 2001;25:402–8.View ArticlePubMedGoogle Scholar
  64. Fleige S, Walf V, Huch S. Comparison of relative mRNA quantification models and the impact of RNA integrity in quantitative real-time RT-PCR. Biotechnol Lett. 2006;28:1601–13.View ArticlePubMedGoogle Scholar

Copyright

© The Author(s). 2017

Advertisement