- Research article
- Open Access
In vitro effects of platelet-rich gel supernatants on histology and chondrocyte apoptosis scores, hyaluronan release and gene expression of equine cartilage explants challenged with lipopolysaccharide
- Jorge U. Carmona1Email authorView ORCID ID profile,
- Diana L. Ríos1,
- Catalina López1,
- María E. Álvarez1, 2,
- Jorge E. Pérez2 and
- Mabel E. Bohórquez3
https://doi.org/10.1186/s12917-016-0759-8
© The Author(s). 2016
- Received: 14 October 2015
- Accepted: 23 June 2016
- Published: 1 July 2016
Abstract
Background
Platelet-rich plasma (PRP) preparations are a common treatment in equine osteoarthritis (OA). However, there are controversies regarding the ideal concentration of platelets and leukocytes in these biological substances necessary to induce an adequate anti-inflammatory and anabolic response in articular cartilage. The aims were to study the influence of leukocyte- and platelet-rich gel (L-PRG) and pure platelet-rich gel (P-PRG) supernatants on the histological changes of cartilage, the degree of chondrocyte apoptosis, the production of hyaluronan (HA) and the gene expression of nuclear factor kappa beta (NFkβ), matrix metalloproteinase 13 (MMP-13), a disintegrin and metalloproteinase with thrombospondin motifs 4 (ADAMTS-4), collagen type I alpha 1 (COL1A1), collagen type II alpha 1 (COL2A1) and cartilage oligomeric matrix protein (COMP) in normal cartilage explants (CEs) challenged with lipopolysaccharide (LPS).
Results
Overall, 25 % L-PRG supernatant (followed in order of importance by, 50 % P-PRG, 25 % P-PRG and 50 % L-PRG) represented the substance with the most important anti-inflammatory and anabolic effect. 25 % P-PRG supernatant presented important anabolic effects, but it induced a more severe chondrocyte apoptosis than the other evaluated substances.
Conclusions
25 % L-PRG supernatant presented the best therapeutic profile. Our results demonstrate that the biological variability of PRP preparations makes their application rather challenging. Additional in vivo research is necessary to know the effect of PRP preparations at different concentrations.
Keywords
- Platelet-rich plasma
- Cartilage explants
- Chondrocyte apoptosis
- Catabolic/anabolic gene expression
- Growth factors
Background
Osteoarthritis (OA) is a chronic inflammatory disease that affects middle aged and older people worldwide [1]. This disease also affects horses and other animal species, which causes economic losses by diminishing the athletic potential of the affected animals and through the chronic use of anti-inflammatory drugs and nutraceuticals [2–4]. Thus, the horse is an important animal model to study both the pathophysiological mechanisms and the experimental treatments of OA [5, 6].
There are several extrinsic factors associated with OA development such as joint repetitive trauma, obesity, joint infection and osteochondrosis, amongst others [4]. During the OA developmental process, there are structural (histological) changes indicating the severity or degree of affectation of the articular cartilage [7]. This includes increased chondrocyte necrosis, cluster (complex chondrone) formation, fibrillation/fissuring, focal cell loss and diminished uptake of safranin-O fast green (SOFG) stain [8]. Furthermore, another important histological change associated with OA is chondrocyte apoptosis, which leads to loss of resident cells in the articular cartilage and results in severe alterations such as impaired extracellular matrix (ECM) remodelling [9]. This phenomenon has been described in both human and animal models of OA [10, 11]. Chondrocyte apoptosis could be detected by caspase-3 expression or terminal deoxynucleotidyl transferase dUTP nick end labelling (TUNEL) staining [12].
Together with the OA histological changes are several joint molecular alterations characterized by nuclear factor kappa beta (NFkβ) upregulation [13] that subsequently upregulates several catabolic and proinflammatory cytokines for cartilage such as interleukin-1 (IL-1) and tumour necrosis factor alpha (TNF-α), matrix metalloproteinases (MMPs - e.g. MMP-13), aggrecanases (i.e. a disintegrin and metalloproteinase with thrombospondin motifs 4 - ADAMTS-4), inducible synthases of nitric oxide and cyclooxygenase type 2 [14]. Consequently, a proinflammatory molecular milieu produces histological alterations in cartilage and induces molecular changes with clinical accompanying indicators such as pain and synovial effusion [4].
In the initial OA stages, joint tissues (e.g. cartilage) act by upregulating anabolic gene expression to induce cartilage ECM anabolism and to increase the synthesis of collagen type II alpha 1 (COL2A1), cartilage oligomeric matrix protein (COMP) and hyaluronan (HA) amongst other anabolic ECM components. However, as the OA progresses, the local expression and production of collagen type I alpha 1 (COL1A1) appears as a poor anabolic response by the osteoarthritic cartilage [15, 16].
Platelet-rich plasma (PRP) has been used as a therapy for OA in humans [17–19] and animals [20–23]. The rationale for the therapeutic use of PRP stems from the fact that platelets (PLTs) (but also white blood cells –WBC-) contained in PRP represent an important autologous source of some growth factors (GFs), which include transforming growth factor beta 1 (TGF-β1), platelet derived growth factor isoform BB (PDGF-BB) [24, 25], and other anti-inflammatory cytokines such as interleukin 4 (IL-4) and the receptor antagonist of IL-1 (IL-1ra) [26, 27], which are implicated in the anabolic characteristics of OA [4, 28]. Furthermore, in vitro studies have revealed that PDGF-BB downregulates NFkβ [29, 30] and increases the proliferation of chondrocytes [29, 31], whereas TGF-β1 increases the cartilage extracellular matrix (ECM) synthesis and promotes the differentiation of stem cells in chondrocytes [32].
Currently, there is controversy about which PRP preparation is ideal for the intra-articular treatment of patients with OA [33, 34]. Some in vitro [35–37] and clinical studies have suggested that leukoreduced PRP (also known as pure PRP [P-PRP]) preparations have better anabolic and anti-inflammatory effects for OA treatment than leukoconcentrate PRP (L-PRP) preparations, whereas other studies have described similar positive effects for both preparations [32, 38, 39].
Recently, we demonstrated in an in vitro system of cartilage inflammation that 50 % L-PRP releasate produced a more sustained temporal concentration of growth factors and anti-inflammatory cytokines than both 25 % L-PRP and P-PRP releasates and 50 % P-PRP releasate in relation to the concentration in culture media [40]. However, there is no information regarding the effects of these substances on the histology or ECM cartilage gene expression.
The study presented here shows complementary and novel information for the anabolic, anti-inflammatory effect of two supernatant concentrations (25 and 50 %) from both P-PRP and L-PRP preparations on equine cartilage explants (CEs) challenged with lipopolysaccharide (LPS). This research evaluates and compares the influence of both platelet-rich gel (PRG) supernatants on the histological changes of cartilage, the degree of chondrocyte apoptosis, the production of HA and the gene expression of NFkB, MMP-13, ADAMTS-4, COL1A1, COL2A1 and COMP in an in vitro system of cartilage inflammation and degeneration.
The hypothesis of this study is that L-PRG supernatants at a lower concentration (25 %) have better anti-inflammatory and anabolic effects than both PRG supernatants at the higher 50 % concentration and P-PRG supernatant at 25 % concentration in CEs challenged with LPS.
Methods
This study was approved by the committee on animal experimentation of the Universidad de Caldas, Manizales, Colombia.
Samples
Cartilage samples from the metacarpophalangeal joints from six horses, aged 4 to 9 years, were included in this study. The samples were taken from horses that were free from musculoskeletal disease and euthanised by a pentobarbital intravenous overdose for other medical reasons. All metacarpophalangeal joints were radiographed and macroscopically evaluated to exclude horses with OA-associated joint changes.
L-PRP and P-PRP preparation
Schematic workflow of the experiments of the study
Both PRP preparations were activated with calcium gluconate (Ropsohn Therapeutics Ltda®, Bogotá, Colombia) (ratio 1:10) and incubated at 37 °C for 1 h until clot retraction occurred. Fresh L-PRG and P-PRG supernatants were used to add to the culture media at two concentrations (25 % and 50 %). Aliquots of both PRG supernatants obtained were frozen at -86 °C for later quantification of PDGF-BB, TGF-β1 and HA.
Cartilage explants culture and LPS challenge
Cartilage samples were obtained aseptically, and circular 4 mm diameter explants were obtained using a disposable biopsy punch (KAI Medical, Solingen, Germany). CEs were dissected from the articular surface without calcified cartilage layers and washed in phosphate-buffered saline.
CEs were stabilised in Dulbecco’s Modified Eagle Medium (DMEM) (high glucose, 4500 mg/L) with L-glutamine and sodium bicarbonate and free of sodium pyruvate (DMEM, Lonza Group Ltd, Basel, Switzerland) and supplemented with streptomycin (100 μg/mL) and penicillin (100 μg/mL) without the addition of serum. Cultures were incubated in a 5 % CO2 and water saturated atmosphere for 24 h and then replaced with fresh culture media. At this time point (24 h), the CEs were challenged with 100 ng/mL of LPS (Sigma-Aldrich, St Louis, MO, USA) to induce inflammatory/catabolic damage of the cartilage [42, 43].
Study design
A total of 30 CEs were obtained from each horse. The study design included the evaluation of six experimental groups using five CEs per group from each horse as follows: one CE healthy control group without LPS and without addition of any PRG supernatant, one CE control group challenged with LPS and without addition of any PRG supernatant, and four CE groups cultured with L-PRG and P-PRG supernatants at two different concentrations (25 % and 50 %). After 1 h of incubation, L-PRG and P-PRG supernatants were added in order to obtain concentrations at 25 and 50 %. All CE groups were cultured at 96 h, after which the culture media were frozen in aliquots at -86 °C for later determination of HA concentration by ELISA. Furthermore, the CEs were deposited in buffered formaldehyde for histological analysis or in an RNA conserving solution (RNAlater, Life Technologies, Carlsbad, CA, USA) for quantitative gene expression of NFkB, MMP-13, ADAMTS-4, COL1A1, COL2A1 and COMP. The schematic diagram (Fig. 1) summarises the study design and methodology.
ELISA analysis
L-PRG and P-PRG supernatants and culture media at 96 h were used to determine the concentration of PDGF-BB, TGF-β1 and HA via ELISA in duplicate. All proteins were assayed using commercial ELISA development kits from R&D Systems (Minneapolis, MN, USA). PDGF-BB (Human PDGF-BB DuoSet, DY220) and TGF-β1 (Human TGF-β1 DuoSet, DY240E) were determined using human antibodies because there is a high sequence homology between these proteins in humans and horses [44, 45]. Furthermore, these kits have been used for the same purposes in other equine PRP studies [24, 25]. HA (Hyaluronan, DuoSet, DY3614) was determined using a multispecies detection ELISA kit. Standards provided for each ELISA kit were used to prepare each standard curve following the manufacturers’ instructions. Absorbance readings were performed at 450 nm.
H&E histology evaluation
Microscopic grading system for articular cartilage histology [8]
Articular cartilage | ||
---|---|---|
Outcome parameter | Score | Description |
Chondrocyte necrosis* | 0 | Normal section without necrosis |
1 | No more than one necrotic cell located near the articular surface per 20x objective | |
2 | 1e2 necrotic cells located near the articular surface per 20x objective | |
3 | 2e3 necrotic cells located near the articular surface per 20x objective | |
4 | 3e4 necrotic cells located near the articular surface per 20x objective | |
Cluster (complex chondrone) formation | 0 | No cluster formation throughout section |
1 | Two chondrocytes (doublets) within same lacunae along superficial aspect of the articular cartilage section | |
2 | 2e3 chondrocytes (doublets & triplets) within same lacunae along superficial aspect of the articular cartilage section | |
3 | 3e4 chondrocytes within same lacunae along superficial aspect of the articular cartilage section | |
4 | Greater than four chondrocytes within same lacunae along superficial aspect of the articular cartilage section | |
Fibrillation/fissuring | 0 | No fibrillation/fissuring of the articular cartilage surface |
1 | Fibrillation/fissuring of the articular cartilage restricted to surface and superficial zone | |
2 | Fissuring that extends into the middle zone | |
3 | Fissuring that extends to the level of the deep zone | |
4 | Fissuring that extends into the deep zone | |
Focal cell loss* | 0 | Normal cell population throughout the section |
1 | A 10e20% area of acellularity per 20x field | |
2 | A 20e30% area of acellularity per 20x field | |
3 | A 40e50% area of acellularity per 20x field | |
4 | A greater than 50 % area of acellularity per 20x field | |
Safranin-O stain uptake | 0 | Normal staining |
1 | Less than 25 % loss of staining characteristics | |
2 | 25e50% loss of staining characteristics | |
3 | 50e75% loss of staining characteristics | |
4 | Greater than 75 % loss of staining characteristics |
These variables were quantified using a 0–4 scale, with 0 being normal and 4 being abnormal (Table 1). Thus, a totally normal CE would score 0 and a maximally abnormal CE would score 15 [8]. Three sections randomly selected from each sample were evaluated blindly and the average score was used for comparison.
TUNEL assay for chondrocyte apoptosis
TUNEL staining was performed to detect DNA strand breakage using a commercial kit for cell and tissues (TACS TdT-Blue Label In situ Apoptosis Detection Kit, Trevigen, Inc., Gaitherburg, MD, USA). Briefly, the CEs were washed and dehydrated in serial alcohol concentrations, fixed in wax blocks and cut into 3 μm slices. The tissue sections were deparaffinised with xylene and ethanol and washed with PBS. The samples were covered with 50 μl of proteinase K solution and incubated for 15 min at 37 °C in a humidity chamber. The samples were washed with PBS and covered with 50 μl of labelling reaction mix. After this, the samples were immersed in a stop buffer solution for 5 min at room temperature to stop labelling reaction and once more washed twice with PBS for 2 min at room temperature. The samples were covered with 50 μl of antibody solution and incubated for 30 min at 37 °C then washed with PBS and covered with 50 μl of TACS Blue Label™ (Trevigen, Inc., Gaitherburg, MD, USA). These samples were washed with deionised water and counterstained with nuclear fast red. The controls were treated similarly except that terminal deoxynucleotidyl transferase was substituted by distilled water [46].
After the reaction, stained chondrocytes (grey-black) were analysed under a light microscope. Chondrocyte apoptosis was scored by a semiquantitative approach using a 0-4 scale, where 1 = 6–25 % of chondrocyte apoptosis; 2 = 26–50 % of chondrocyte apoptosis; 3 = 51–75 % of chondrocyte apoptosis and 4 = 76–100 % of chondrocyte apoptosis [47].
Molecular evaluation
CE samples were pulverised in liquid nitrogen and mixed with TRIzol reagent (Life Technologies, Carlsbad, CA, USA) for 5 min. The samples were centrifuged for 10 min at 10,000 × g, and the supernatant was mixed with 20 % chloroform (volume/volume) and then centrifuged for 15 min at 12,000 × g. The aqueous phase of the samples was removed and transferred to special columns (PureLink RNA Mini Kit, Life Technologies, Carlsbad, CA) for RNA extraction according to the manufacturer’s instructions. RNA concentrations were measured using a spectrophotometer (Nanodrop 2000, Thermo Scientific, Wilmington, DE, USA). Samples were diluted to a concentration of 5 ng/μL of RNA.
Genes and sequence of primers evaluated in the study
Targeted genes | Primer sequences (5'- > 3') | Product size (bps) |
---|---|---|
GAPDH, glyceraldehyde-3-phosphate dehydrogenase 6 | Forward TCCCTGCTTCTACTGGTGCT Reverse TGACAAAGTGGTCGTTGAGG | 306 |
NFkβ, nuclear factor of kappa light polypeptide gene enhancer in B-cells-like 1 | Forward CGATTTCGATATGGCTGTGA Reverse CACCTTCTTCAGCTCCTTGG | 399 |
MMP 13, matrix metallopeptidase 13 (collagenase 3) 7 | Forward GCATTCAAAAAGGCCTTCAA Reverse GGAAGCACAAAGTGGCTTTT | 356 |
ADAMTS 4, metallopeptidase with thrombospondin type 1 motif 4 | Forward TGTCAGCTTGGTGGTGACTC Reverse GTTGAAGACATGGCCCAGTT | 322 |
COL1A1, collagen, type I, alpha 1 11 | Forward AGCCAGCAGATCGAGAACAT Reverse CTGGCCACCATACTCGAACT | 309 |
COL2A1, collagen, type II, alpha 1 6 | Forward primer ACGTCCAGATGACCTTCCTG Reverse primer GTCCACACCAAATTCCTGCT | 326 |
COMP, cartilage oligomeric matrix protein 21 | Forward CCACGTGAATACGGTCACAG Reverse TAGGAACCAGCGGTAGGATG | 301 |
The relative change in gene expression was determined via the comparative 2-ΔΔCT method [48]. GAPDH was used as the internal control (housekeeping gene), and cartilage samples from all horses that were not incubated with any treatment were used as reference samples.
Statistical and data analysis
The statistical analysis was performed with SPSS 19.0 software (IBM, Chicago, IL, USA). The Shapiro–Wilk test was used to assess the fit of the data set to a normal distribution (goodness of fit). All the parameters evaluated, except CE histology and apoptosis scores, demonstrated a normal distribution (p > 0.05). However, these data were normalised by using a transformation log (Y).
Platelet and WBC counts in whole blood and both PRP preparations were evaluated through a one-way analysis of variance (ANOVA), followed by a Tukey test. PDGF-BB, TGF-β1 and HA concentrations from both PRG supernatants were compared using a t-non-paired test. A generalised lineal model (GLM), followed (when necessary) by a Tukey test, was used for comparing HA concentrations in culture media and gene expression at 96 h. The HA concentrations in fresh culture media with PRG supernatants at 1 h and 96 h were compared using a t-paired test. A p < 0.05 was accepted as statistically significant for all tests. Data are presented as mean ± mean standard error (m.s.e).
Results
Cell, growth factor and HA in L-PRP/L-PRG and P-PRP/P-PRG
PLT counts were significantly (p < 0.05) different between whole blood, L-PRP and P-PRP, with the lowest concentration for P-PRP (98.7 00 ± 4.600 PLT/μL), followed by whole blood (125.900 ± 3.400 PLT/μL) and L-PRP (312.800 ± 19.600 PLT/μL). WBC counts were also significantly different between the evaluated groups, with a higher concentration for L-PRP (35.100 ± 3.500 WBC/μL), followed by whole blood (8.300 ± 3.700 WBC/μL) and P-PRP (110 ± 40 WBC/μL). TGF-β1 concentration was similar between L-PRG (1676.3 ± 312.4 pg/mL) and P-PRG (1356.9 ± 20.8 pg/mL). PDGF-BB had a significantly (p < 0.05) higher concentration in L-PRG (3053. 8 ± 956.7 pg/mL) when compared to P-PRG (372.7 ± 79.6 pg/mL). HA concentration was significantly (p < 0.05) higher in L-PRG supernatant (4.3 ± 1.7 pg/mL) in comparison to P-PRG supernatant (1.1 ± 0.21 pg/mL).
H&E histology evaluation
Means (±standard error of the mean [s.e.m]) of the cartilage histology and chondrocyte apoptosis scores. a Chondrocyte necrosis. b Cluster formation. c Fibrillation/fissuring. d Focal cell loss. e SOFG stain uptake. f Total histology score. g Chondrocyte apoptosis. a-bDifferent lowercase letters denote significant (p ˂ 0.05) differences between the groups evaluated by the Tukey test
Fibrillation/fissuring scores were significantly (p < 0.05) higher in both control groups, although there was a statistical trend (p = 0.10) showing CEs of the healthy control group with lower score in comparison to CEs of the control group treated with LPS. In general, CEs treated with all PRG supernatants presented significantly (p < 0.05) lower scores. However, CEs treated with 50 % L-PRG and 25 % P-PRG supernatants were significantly lower than CEs of healthy control group (Fig. 2c).
Focal cell loss scores were significantly (p < 0.05) worse for the CEs of control group treated with LPS and those treated with 50 % P-PRG supernatant. CEs from the healthy control group and those treated with both 25 % PRG supernatants presented significantly (p < 0.05) lower scores than the rest of the CE groups (Fig. 2d). SOFG stain uptake score were significantly (p < 0.05) worse for CEs treated with 50 % L-PRG supernatant, followed by CEs of the control group challenged with LPS and both 25 % PRG supernatants. The best score for this histology parameter was found in CEs of the healthy control group and those treated with 50 % P-PRG supernatant (Fig. 2e).
The general histology total score was significantly (p < 0.05) higher in CEs of the control group challenged with LPS when compared to CEs of the healthy control group and those treated with both L-PRG and 25 % P-PRG supernatant. In general, CEs treated with both 25 % PRG supernatants showed significantly (p < 0.05) better general histology score than the rest of the groups evaluated (Fig. 2f).
TUNEL assay for chondrocyte apoptosis
No chondrocyte apoptosis was detected in CEs of the healthy control group and those treated with both 50 % PRG supernatants. However, this cellular phenomenon was detected (and it was significantly higher [p < 0.05]) in CEs of the control group challenged with LPS and those treated with both 25 % PRG supernatants; although, the score for this parameter was apparently lower for those CEs treated with 25 % L-PRG supernatant (Fig. 2g).
Concentration of HA in culture media at 1 h and 96 h
Means (± s.e.m) of HA concentration in culture media from cartilage explant (CE) groups at 1 h and 96 h. a-b Different lowercase letters denote significant (p < 0.05) differences between the groups evaluated by the Tukey test over the same period of time. * Denotes significant differences between the same variable at different time periods by the t-paired test
Gene expression
Means (± s.e.m) of NFkB gene expression in CE groups at 96 h. a-b Different lowercase letters denote significant (p < 0.05) differences between the groups evaluated by the Tukey test
Means (± s.e.m) of MMP-13 gene expression in CE groups at 96 h a-b Different lowercase letters denote significant (p < 0.05) differences between the groups evaluated by the Tukey test
Means (± s.e.m) of ADAMTS-4 gene expression in CE groups at 96 h. a-b Different lowercase letters denote significant (p < 0.05) differences between the groups evaluated by the Tukey test
Means (± s.e.m) of COL1A1 gene expression in CE groups at 96 h. a-b Different lowercase letters denote significant (p < 0.05) differences between the groups evaluated by the Tukey test
Means (± s.e.m) of COL2A1 gene expression in CE groups at 96 h. a-b Different lowercase letters denote significant (p < 0.05) differences between the groups evaluated by the Tukey test
Means (± s.e.m) of COMP gene expression in CE groups at 96 h. a-b Different lowercase letters denote significant (p < 0.05) differences between the blood component groups obtained with the same anticoagulant by the Tukey test
Discussion
Diverse PRP effects on cells and tissues are well recognised as depending on their varying preparations [38]. Thus, the molecular profile of a PRG supernatant is associated with the type and quantity of WBCs and PLTs initially present in PRP [25, 28]. However, after PRP is activated in a joint, it becomes a fibrin mesh or PRG that releases growth factors and cytokines and acts as an immune node inside the joint [49]. We currently believe that the cell ratio (PLT:WBC) in PRP is not as critical as the GF:GF or GF:cytokine ratios and concentrations released into the joint fluid [50]. However, we also wish to clarify that this assumption could possibly be valid for the use of PRP in joints and not for the infiltrative use of this substance in tendons, ligaments or muscles, where not only is the growth factor concentration important, but also the fibrin mesh to allow growth factor storage, cell migration and cell proliferation [51].
Strong debates continue about the ideal PLT:WBC ratio and concentration in PRP [51]. Currently, there are several studies indicating that plasma with a poor quantity of PLTs and negligible WBs could be the best “PRP” preparations to treat OA and other musculoskeletal pathologies [35, 36, 52]. However, a recent in vitro study described molecular positive effects for several commercial kits which have concentrates at different PLT:WBC ratios and are used for OA treatment [39].
Thus, we decided to conduct an independent study to evaluate the effect of two different PRP preparations (obtained by a homemade lab method) at different concentrations on cartilage histology, chondrocyte apoptotic scores, HA release and catabolic and anabolic gene expression of CEs challenged with LPS. Exposure of CEs to LPS resulted in marked changes in the expression of genes involved in matrix formation and degradation as well as inflammation of which many were reduced by the addition of both PRG supernatants at different concentrations.
The use of LPS for inducing cartilage inflammation/degeneration is a classical methodological approach to perform diverse in vitro studies by simulating a system of inflammatory/degenerative arthropaty [42, 43, 53]; although, the use of recombinant IL-1β to induce in vitro articular cartilage degradation could be more suitable [54, 55]. However, it is important to clarify that the cellular receptors for LPS and IL-1β are closely interlinked and described as the TLR-IL-1 receptor (IL-1R) superfamily of receptors. When activated they induce a series of intercellular signalling pathways that converge on the activation of the transcription NFkB resulting in pro-inflammatory cytokine expression [55, 56].
It is important to mention that the evaluation of the anti-inflammatory effect of PRG supernatants by measuring the relative expression of the NFkB gene in the present study represents a very limited approach to understanding the activity signalling of this important inflammatory process [57]. However, an in vitro study in human chondrocytes revealed that activated PRP induced the expression and production of inhibitor-ĸBα (IĸBα) (directly mediated by hepatocyte growth factor), which is responsible for the inhibition of the transcription of NFkB [58]. This finding has also been consistent for gingival fibroblasts and alveolar osteoblasts challenged with LPS and cultured with PRP preparations [59].
Notably, LPS challenge induced important structural (degenerative) changes accompanied with chondrocyte apoptosis in CEs, which were reverted or ameliorated in diverse degrees by PRG supernatants. However, the general histology score was significantly lower (better) for CEs treated with PRG supernatants, and some individual outcome parameters, such as chondrocyte necrosis, focal cell loss and SOFG uptake, were affected by some of these substances.
Chondrocyte necrosis was mostly observed in CEs treated with 25 % L-PRG and 50 % P-PRG supernatants. This finding could indicate that these substances at these specific concentrations were not able to reverse the catabolic effect mediated by endotoxin in CEs. Furthermore, it is also important to consider that both 25 % PRG supernatants presented chondrocyte apoptosis reaction similar to those observed in CEs from the control group challenged with LPS; although, CEs treated with 25 % P-PRG supernatant presented the highest score for this parameter. This last finding could possibly indicate that this substance at lower concentration is not able to reverse the cartilage catabolic effects of LPS and can induce additional chondrocyte apoptosis.
Focal cell loss was more evident for both 50 % PRG supernatants, possibly due to that chondrocytes being able to migrate inside the CEs towards the periphery through a chemotactic attractive stimulus in the culture media [60], such as the milieu of growth factors released from PRP [61–63]. In contrast, another explanation to demonstrate the cause of focal cell loss in the groups of CEs treated with higher concentrations of PRG supernatants could be attributed to chondrocyte necrosis or even chondrocyte apoptosis [64]. However, this lack of significant increase of these parameters occurred only for CEs treated with 50 % P-PRG supernatant, which could indicate that P-PRG preparations were not chondroprotective.
The SOFG uptake score was higher in CEs treated with 50 % L-PRG and 25 % P-PRG supernatants, and apparently this parameter was worst for CEs treated with 50 % L-PRG supernatant. This parameter is associated with the structural content of proteoglycans in the cartilage ECM [8], which indicate the quality and integrity of this structure. It is important to consider that 50 % L-PRG supernatant also induced downregulation of anabolic ECM genes, such as COL2A1 and COMP. Taken together, these histology and molecular findings indicate that higher concentrations of L-PRP preparations could be deleterious for osteoarthritic cartilage. One pitfall of the present research was that the release or accumulation of proteoglycans was not measured in the culture media of CEs. However, we consider that the combination of histology parameters and gene expression could be valid indicators for the degree of affection of ECM of the CEs of this study.
The combination of the general histology score, chondrocyte apoptosis findings, HA release to the culture media and the catabolic and anabolic cartilage ECM gene expression demonstrated that all PRG supernatants are “biosubstances” with mixed biological effects. In general, all PRG supernatants presented a potential anti-inflammatory effect and decreased the catabolic effects of LPS on CEs at the cellular and molecular level. However, the overall analysis of our results indicates that 25 % L-PRG supernatant (followed in order of importance by 50 % P-PRG, 25 % P-PRG and 50 % L-PRG) represented the substance with the most important anti-inflammatory and anabolic effect with lower affection of CEs at the histology level. Furthermore, 25 % P-PRG supernatant presented important anabolic effects, but it induced a more severe chondrocyte apoptosis than the other of the evaluated substances. This detrimental cell effect limits the potential clinical use of this substance at this concentration.
The present results can be complemented with the previous findings obtained by us in two in vitro studies, in which the production of anti-inflammatory and catabolic cytokines was measured in the culture media of synovial membrane explants (SME) [27] and CEs [40] challenged with LPS over 48 h and 96 h. In general, 25 % L-PRG and 50 % L-PRG supernatants presented the best anabolic and anti-inflammatory profile. However, in both studies, 25 % L-PRG supernatant produced a most significant reduction of TNF-α production and a total higher production of IL-1ra over time than 50 % L-PRG [27, 40].
Currently, we use 3-5 mL doses of PRP to treat fetlock osteoarthritis in horses with a body weight of 300-450 kg. This PRP volume has also been used for other researches with good results [22]. Notably, the complete volume capacity for an equine fetlock joint has been calculated at 12.5 ± 1.0 mL [65]. Thus, if the PRP volume used is adjusted in relation to the volume capacity of this specific joint [65], the effective concentration of PRP in clinical conditions could be near to 40 %, without considering the additional volume of synovial fluid (2-2.5 mL), which could represent a final PRP/synovial fluid concentration of 40-60 %. In line with this, the PRP dose for this joint could possibly be adjusted at 25 % using between 1.5-2.0 mL. However, this hypothesis should be probed in patients with osteoarthritis or experimentally induced synovitis.
Our findings are in line with the results of Cavallo et al. [39] and Kreuz et al.[38], who found diverse and positive effects for L- and P-PRP preparations in human osteoarthritic chondrocytes and subchondral mesenchymal progenitor cells. Conversely, our results are different from other in vitro studies [34–36], which have concluded that only P-PRP preparations induce an anabolic effect in cartilage and L-PRP preparations only induce an opposite (catabolic) joint state.
This study had several limitations. First, this is an in vitro study, which does not reflect the exact biological phenomena occurring in the osteoarthritic joint. However, this in vitro system of cartilage inflammation and degeneration could be useful to demonstrate that L- and P-PRG supernatants could act in function of their concentration and could have different mechanisms of action to induce cartilage joint anabolism and, potentially, diminish pain and inflammation. Another limitation of this study was that blood of only one animal was used to produce the PRG supernatants evaluated to avoid the great variability in the CE responses to several PRP preparations. This situation is not practical in clinical conditions because autologous PRP should be used. However, the response of each patient in particular will depend in some measure on the concentration of the cells’ proteins in PRP.
Conclusions
This study demonstrates that both L- and P-PRP preparations at different concentrations can induce different anti-inflammatory, anti-catabolic, anabolic and even catabolic responses in an in vitro system of cartilage inflammation and degeneration.
Apparently, 25 % L-PRG supernatant presented the best therapeutic profile when compared to the other PRP preparations examined, because it presented anti-inflammatory and anabolic effects with minimal cellular and structural changes in CEs. Our results once more demonstrate that the biological variability of PRP preparations makes their application rather challenging. Additional studies in animal models and in patients with OA should be performed to know the in vivo effect of PRP preparations at different concentrations.
Abbreviations
ADMTS-4, A disintegrin and metalloproteinase with thrombospondin motifs 4; ANOVA, analysis of variance; CEs, cartilage explants; COL1A1, collagen type I alpha 1; COL2A1, collagen type II alpha 1; COMP, cartilage oligomeric matrix protein; DMEM, Dulbecco’s modified Eagle medium; ECM, extracellular matrix; ELISA, enzyme-linked immunosorbent assay; GF, growth factor; HA, hyaluronan; IL-1, interleukin 1; L-PRG, leukoconcentrated platelet-rich gel; L-PRP, leukoconcentrated platelet-rich plasma; LPS, lipopolysaccharide; MMP-13, matrix metalloproteinase 13; NFkβ, nuclear factor kappa beta; OA, osteoarthritis; PDGF-BB, platelet derived growth factor isoform BB; PLT, platelet; P-PRG, pure platelet-rich gel; P-PRP, pure platelet-rich plasma; PRG, platelet-rich gel; PRP, platelet-rich plasma; RBC, red blood cell; TGF-β1, transforming growth factor beta-1; TNF-α, tumor necrosis factor alpha; WBC, leukocyte.
Declarations
Acknowledgments
The authors thank Wilson Gómez and Fabio Robayo for their assistance and thank Policía Nacional de Colombia.
Funding
This project was supported by grant No.397-2011 of the National Program of Biotechnology from COLCIENCIAS, Bogotá D.C and by grant No 0250911 of the Vicerrectoría de Investigaciones y Postgrados of the Universidad de Caldas, Manizales, Colombia. D.L.R´s PhD scholarship was funded by COLCIENCIAS.
Availability of data and materials
All data supporting our findings are included in the manuscript. However, if readers need additional data of this study, these will be provided by the corresponding author carmona@ucaldas.edu.co (J.U. Carmona).
Authors’ contributions
JUC had full access to all of the data in the study and takes responsibility for the decision to submit this work for publication. JUC designed the study and participated in data analysis and interpretation, manuscript drafting and critical revision. CL, DLR, MEA, JEP and MEB performed laboratory work and contributed to data collection, data analysis and interpretation and critical revision of the manuscript. All of the authors read and approved the final version of the manuscript to be published.
Competing interests
The authors declare that they have no competing interests.
Consent for publication
Not applicable.
Ethics approval and consent to participate
This study was approved by the committee on animal experimentation of the Universidad de Caldas, Manizales, Colombia. Cadaveric material was obtained under authorization of the owner of the horses (Policía Nacional de Colombia). The mare used for blood collection is owned by Universidad de Caldas and is under responsibility of JUC.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
Authors’ Affiliations
References
- Marshall DA, Vanderby S, Barnabe C, MacDonald KV, Maxwell C, Mosher D, Wasylak T, Lix L, Stat P, Enns E, et al. Estimating the burden of osteoarthritis to plan for the future. Arthritis Care Res. 2015;4(10):22612.Google Scholar
- Aragon CL, Hofmeister EH, Budsberg SC. Systematic review of clinical trials of treatments for osteoarthritis in dogs. J Am Vet Med Assoc. 2007;230(4):514–21.View ArticlePubMedGoogle Scholar
- Vandeweerd JM, Coisnon C, Clegg P, Cambier C, Pierson A, Hontoir F, Saegerman C, Gustin P, Buczinski S.Systematic review of efficacy of nutraceuticals to alleviate clinical signs of osteoarthritis. J Vet Intern Med. 2012;26(3):448–56.View ArticlePubMedGoogle Scholar
- Carmona JU, Prades M. Pathophisiology of osteoarthritis. Comp Equine. 2009;4(1):28–40.Google Scholar
- McIlwraith CW, Fortier LA, Frisbie DD, Nixon AJ. Equine models of articular cartilage repair. Cartilage. 2011;2(4):317–26.View ArticlePubMedPubMed CentralGoogle Scholar
- McCoy AM. Animal models of osteoarthritis: comparisons and key considerations. Vet Pathol. 2015;10:0300985815588611.Google Scholar
- Neundorf RH, Lowerison MB, Cruz AM, Thomason JJ, McEwen BJ, Hurtig MB. Determination of the prevalence and severity of metacarpophalangeal joint osteoarthritis in Thoroughbred racehorses via quantitative macroscopic evaluation. Am J Vet Res. 2010;71(11):1284–93.View ArticlePubMedGoogle Scholar
- McIlwraith CW, Frisbie DD, Kawcak CE, Fuller CJ, Hurtig M, Cruz A. The OARSI histopathology initiative - recommendations for histological assessments of osteoarthritis in the horse. Osteoarthritis Cartilage. 2010;18 Suppl 3:S93–105.View ArticlePubMedGoogle Scholar
- Zamli Z, Sharif M. Chondrocyte apoptosis: a cause or consequence of osteoarthritis? Int J Rheum Dis. 2011;14(2):159–66.View ArticlePubMedGoogle Scholar
- Chang CH, Hsu YM, Chen YC, Lin FH, Sadhasivam S, Loo ST, Savitha S. Anti-inflammatory effects of hydrophilic and lipophilic statins with hyaluronic acid against LPS-induced inflammation in porcine articular chondrocytes. J Orthop Res. 2014;32(4):557–65.View ArticlePubMedGoogle Scholar
- Franciozi CE, Tarini VA, Reginato RD, Goncalves PR, Medeiros VP, Ferretti M, Dreyfuss JL, Nader HB, Faloppa F. Gradual strenuous running regimen predisposes to osteoarthritis due to cartilage cell death and altered levels of glycosaminoglycans. Osteoarthritis Cartilage. 2013;21(7):965–72.View ArticlePubMedGoogle Scholar
- Otsuki Y, Li Z, Shibata MA. Apoptotic detection methods--from morphology to gene. Prog Histochem Cytochem. 2003;38(3):275–339.View ArticlePubMedGoogle Scholar
- Marcu KB, Otero M, Olivotto E, Borzi RM, Goldring MB. NF-kappaB signaling: multiple angles to target OA. Curr Drug Targets. 2010;11(5):599–613.View ArticlePubMedPubMed CentralGoogle Scholar
- Ownby SL, Fortuno LV, Au AY, Grzanna MW, Rashmir-Raven AM, Frondoza CG. Expression of pro-inflammatory mediators is inhibited by an avocado/soybean unsaponifiables and epigallocatechin gallate combination. J Inflamm (Lond). 2014;11(1):8. doi:10.1186/1476-9255-1111-1188.View ArticleGoogle Scholar
- Ishijima M, Kaneko H, Kaneko K. The evolving role of biomarkers for osteoarthritis. Ther Adv Musculoskelet Dis. 2014;6(4):144–53.View ArticlePubMedPubMed CentralGoogle Scholar
- Aigner T, Bartnik E, Zien A, Zimmer R. Functional genomics of osteoarthritis. Pharmacogenomics. 2002;3(5):635–50.View ArticlePubMedGoogle Scholar
- Campbell KA, Saltzman BM, Mascarenhas R, Khair MM, Verma NN, Bach Jr BR, Cole BJ. Does intra-articular platelet-rich plasma injection provide clinically superior outcomes compared with other therapies in the treatment of knee osteoarthritis? A systematic review of overlapping meta-analyses. Arthroscopy. 2015;29(15):00353–9.Google Scholar
- Say F, Gurler D, Yener K, Bulbul M, Malkoc M. Platelet-rich plasma injection is more effective than hyaluronic acid in the treatment of knee osteoarthritis. Acta Chir Orthop Traumatol Cech. 2013;80(4):278–83.PubMedGoogle Scholar
- Jang SJ, Kim JD, Cha SS. Platelet-rich plasma (PRP) injections as an effective treatment for early osteoarthritis. Eur J Orthop Surg Traumatol. 2013;23(5):573–80.View ArticlePubMedGoogle Scholar
- Brossi PM, Moreira JJ, Machado TS, Baccarin RY. Platelet-rich plasma in orthopedic therapy: a comparative systematic review of clinical and experimental data in equine and human musculoskeletal lesions. BMC Vet Res. 2015;11:98.View ArticlePubMedPubMed CentralGoogle Scholar
- Carmona JU, Argüelles D, Climent F, Prades M. Autologous platelet concentrates as a treatment of horses with osteoarthritis: a preliminary pilot clinical study. J Equine Vet Sci. 2007;27(4):167–70.View ArticleGoogle Scholar
- Pichereau F, Décory M, Cuevas Ramos G. Autologous platelet concentrate as a treatment for horses with refractory fetlock osteoarthritis. J Equine Vet Sci. 2014;34(4):489–93.View ArticleGoogle Scholar
- Silva RF, Carmona JU, Rezende CM. Intra-articular injections of autologous platelet concentrates in dogs with surgical reparation of cranial cruciate ligament rupture: a pilot study. Vet Comp Orthop Traumatol. 2013;26(4):285–90.View ArticlePubMedGoogle Scholar
- Giraldo CE, Alvarez ME, Carmona JU. Effects of sodium citrate and acid citrate dextrose solutions on cell counts and growth factor release from equine pure-platelet rich plasma and pure-platelet rich gel. BMC Vet Res. 2015;11:60.View ArticlePubMedPubMed CentralGoogle Scholar
- Giraldo CE, Lopez C, Alvarez ME, Samudio IJ, Prades M, Carmona JU. Effects of the breed, sex and age on cellular content and growth factor release from equine pure-platelet rich plasma and pure-platelet rich gel. BMC Vet Res. 2013;9:29.View ArticlePubMedPubMed CentralGoogle Scholar
- Rios DL, Lopez C, Carmona JU. Platelet-rich gel supernatants stimulate the release of anti-inflammatory proteins on culture media of normal equine synovial membrane explants. Vet Med Int. 2015;2015:547052.View ArticlePubMedPubMed CentralGoogle Scholar
- Rios DL, López C, Álvarez ME, Samudio I, Carmona JU. Effects over time of two platelet gel supernatants on growth factor, cytokine and hyaluronan concentrations in normal synovial membrane explants challenged with lipopolysaccharide. BMC Musculoskelet Disord. 2015;16:153.View ArticlePubMedPubMed CentralGoogle Scholar
- Andia I, Maffulli N. Platelet-rich plasma for managing pain and inflammation in osteoarthritis. Nat Rev Rheumatol. 2013;9(12):721–30. doi:10.1038/nrrheum.2013.1141. Epub 2013 Oct 1031.View ArticlePubMedGoogle Scholar
- Stewart K, Pabbruwe M, Dickinson S, Sims T, Hollander AP, Chaudhuri JB. The effect of growth factor treatment on meniscal chondrocyte proliferation and differentiation on polyglycolic acid scaffolds. Tissue Eng. 2007;13(2):271–80.View ArticlePubMedGoogle Scholar
- Montaseri A, Busch F, Mobasheri A, Buhrmann C, Aldinger C, Rad JS, Shakibaei M. IGF-1 and PDGF-bb suppress IL-1beta-induced cartilage degradation through down-regulation of NF-kappaB signaling: involvement of Src/PI-3 K/AKT pathway. PLoS One. 2011;6(12):e28663.View ArticlePubMedPubMed CentralGoogle Scholar
- Brandl A, Angele P, Roll C, Prantl L, Kujat R, Kinner B. Influence of the growth factors PDGF-BB, TGF-beta1 and bFGF on the replicative aging of human articular chondrocytes during in vitro expansion. J Orthop Res. 2010;28(3):354–60.PubMedGoogle Scholar
- Zhai G, Dore J, Rahman P. TGF-beta signal transduction pathways and osteoarthritis. Rheumatol Int. 2015;15:15.Google Scholar
- Russell RP, Apostolakos J, Hirose T, Cote MP, Mazzocca AD. Variability of platelet-rich plasma preparations. Sports Med Arthrosc. 2013;21(4):186–90.View ArticlePubMedGoogle Scholar
- Sundman EA, Cole BJ, Fortier LA. Growth factor and catabolic cytokine concentrations are influenced by the cellular composition of platelet-rich plasma. Am J Sports Med. 2011;39(10):2135–40.View ArticlePubMedGoogle Scholar
- Kisiday JD, McIlwraith CW, Rodkey WG, Frisbie DD, Steadman JR. Effects of platelet-rich plasma composition on anabolic and catabolic activities in equine cartilage and meniscal explants. Cartilage. 2012;3(3):245–54.View ArticlePubMedPubMed CentralGoogle Scholar
- Sundman EA, Cole BJ, Karas V, Della Valle C, Tetreault MW, Mohammed HO, Fortier LA. The anti-inflammatory and matrix restorative mechanisms of platelet-rich plasma in osteoarthritis. Am J Sports Med. 2014;42(1):35–41.View ArticlePubMedGoogle Scholar
- Braun HJ, Kim HJ, Chu CR, Dragoo JL. The effect of platelet-rich plasma formulations and blood products on human synoviocytes: implications for intra-articular injury and therapy. Am J Sports Med. 2014;42(5):1204–10.View ArticlePubMedGoogle Scholar
- Kreuz PC, Kruger JP, Metzlaff S, Freymann U, Endres M, Pruss A, Petersen W, Kaps C. Platelet-rich plasma preparation types show impact on chondrogenic differentiation, migration, and proliferation of human subchondral mesenchymal progenitor cells. Arthroscopy. 2015;13(15):00260–1.Google Scholar
- Cavallo C, Filardo G, Mariani E, Kon E, Marcacci M, Pereira Ruiz MT, Facchini A, Grigolo B:. Comparison of platelet-rich plasma formulations for cartilage healing: an in vitro study. J Bone Joint Surg Am. 2014;96(5):423–9.View ArticlePubMedGoogle Scholar
- Ríos DL, López C, Carmona JU. Evaluation of the anti-inflammatory effects of two platelet-rich gel supernatants in an in vitro system of cartilage inflammation. Cytokine. 2015;76(2):505–13.View ArticlePubMedGoogle Scholar
- Arguelles D, Carmona JU, Pastor J, Iborra A, Vinals L, Martinez P, Bach E, Prades M. Evaluation of single and double centrifugation tube methods for concentrating equine platelets. Res Vet Sci. 2006;81(2):237–45.View ArticlePubMedGoogle Scholar
- Bolt DM, Ishihara A, Weisbrode SE, Bertone AL. Effects of triamcinolone acetonide, sodium hyaluronate, amikacin sulfate, and mepivacaine hydrochloride, alone and in combination, on morphology and matrix composition of lipopolysaccharide-challenged and unchallenged equine articular cartilage explants. Am J Vet Res. 2008;69(7):861–7.View ArticlePubMedGoogle Scholar
- Byron CR, Orth MW, Venta PJ, Lloyd JW, Caron JP. Influence of glucosamine on matrix metalloproteinase expression and activity in lipopolysaccharide-stimulated equine chondrocytes. Am J Vet Res. 2003;64(6):666–71.View ArticlePubMedGoogle Scholar
- Penha-Goncalves MN, Onions DE, Nicolson L. Cloning and sequencing of equine transforming growth factor-beta 1 (TGF beta-1) cDNA. DNA Seq. 1997;7(6):375–8.View ArticlePubMedGoogle Scholar
- Donnelly BP, Nixon AJ, Haupt JL, Dahlgren LA. Nucleotide structure of equine platelet-derived growth factor-A and -B and expression in horses with induced acute tendinitis. Am J Vet Res. 2006;67(7):1218–25.View ArticlePubMedGoogle Scholar
- Furuta N, Yoshioka I, Fukuizumi T, Tominaga K, Nishihara T, Fukuda J. Morphological features of cartilage observed during mandibular distraction in rabbits. Int J Oral Maxillofac Surg. 2007;36(3):243–9.View ArticlePubMedGoogle Scholar
- Fraser A, Fearon U, Reece R, Emery P, Veale DJ. Matrix metalloproteinase 9, apoptosis, and vascular morphology in early arthritis. Arthritis Rheum. 2001;44(9):2024–8.View ArticlePubMedGoogle Scholar
- Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402–8.View ArticlePubMedGoogle Scholar
- Dohan DM, Choukroun J, Diss A, Dohan SL, Dohan AJ, Mouhyi J, Gogly B. Platelet-rich fibrin (PRF): a second-generation platelet concentrate. Part III: leucocyte activation: a new feature for platelet concentrates? Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 2006;101(3):e51–55.View ArticlePubMedGoogle Scholar
- Giusti I, D'Ascenzo S, Manco A, Di Stefano G, Di Francesco M, Rughetti A, Dal Mas A, Properzi G, Calvisi V, Dolo V. Platelet concentration in platelet-rich plasma affects tenocyte behavior in vitro. Biomed Res Int. 2014;2014:630870. doi:10.1155/2014/630870. Epub 632014 Jul 630823.PubMedPubMed CentralGoogle Scholar
- Dohan Ehrenfest DM, Bielecki T, Mishra A, Borzini P, Inchingolo F, Sammartino G, Rasmusson L, Evert PA. In search of a consensus terminology in the field of platelet concentrates for surgical use: platelet-rich plasma (PRP), platelet-rich fibrin (PRF), fibrin gel polymerization and leukocytes. Curr Pharm Biotechnol. 2012;13(7):1131–7.View ArticlePubMedGoogle Scholar
- McCarrel TM, Minas T, Fortier LA. Optimization of leukocyte concentration in platelet-rich plasma for the treatment of tendinopathy. J Bone Joint Surg Am. 2012, 94(19):e143(141-148).Google Scholar
- Pearson W, Fletcher RS, Kott LS, Hurtig MB. Protection against LPS-induced cartilage inflammation and degradation provided by a biological extract of Mentha spicata. BMC Complement Altern Med. 2010;10(19):1472–6882.Google Scholar
- Santoro A, Conde J, Scotece M, Abella V, Lopez V, Pino J, Gomez R, Gomez-Reino JJ, Gualillo O. Choosing the right chondrocyte cell line: Focus on nitric oxide. J Orthop Res. 2015;27(10):22954.Google Scholar
- Bougault C, Gosset M, Houard X, Salvat C, Godmann L, Pap T, Jacques C, Berenbaum F. Stress-induced cartilage degradation does not depend on the NLRP3 inflammasome in human osteoarthritis and mouse models. Arthritis Rheum. 2012;64(12):3972–81.View ArticlePubMedGoogle Scholar
- Vezina Audette R, Lavoie-Lamoureux A, Lavoie JP, Laverty S. Inflammatory stimuli differentially modulate the transcription of paracrine signaling molecules of equine bone marrow multipotent mesenchymal stromal cells. Osteoarthritis Cartilage. 2013;21(8):1116–24.View ArticlePubMedGoogle Scholar
- Brenner D, Blaser H, Mak TW. Regulation of tumour necrosis factor signalling: live or let die. Nat Rev Immunol. 2015;15(6):362–74.View ArticlePubMedGoogle Scholar
- Bendinelli P, Matteucci E, Dogliotti G, Corsi MM, Banfi G, Maroni P, Desiderio MA. Molecular basis of anti-inflammatory action of platelet-rich plasma on human chondrocytes: mechanisms of NF-kappaB inhibition via HGF. J Cell Physiol. 2010;225(3):757–66.View ArticlePubMedGoogle Scholar
- Anitua E, Zalduendo M, Troya M, Padilla S, Orive G. Leukocyte inclusion within a platelet rich plasma-derived fibrin scaffold stimulates a more pro-inflammatory environment and alters fibrin properties. PLoS One. 2015;10(3):e0121713.View ArticlePubMedPubMed CentralGoogle Scholar
- Morales TI. Chondrocyte moves: clever strategies? Osteoarthritis Cartilage. 2007;15(8):861–71.View ArticlePubMedPubMed CentralGoogle Scholar
- O'Connell GD, Tan AR, Cui V, Bulinski JC, Cook JL, Attur M, Abramson SB, Ateshian GA, Hung CT. Human chondrocyte migration behaviour to guide the development of engineered cartilage. J Tissue Eng Regen Med. 2015, 28(10). doi:10.1002/term.1988.
- Kruger JP, Hondke S, Endres M, Pruss A, Siclari A, Kaps C. Human platelet-rich plasma stimulates migration and chondrogenic differentiation of human subchondral progenitor cells. J Orthop Res. 2012;30(6):845–52.View ArticlePubMedGoogle Scholar
- Schar MO, Diaz-Romero J, Kohl S, Zumstein MA, Nesic D. Platelet-rich concentrates differentially release growth factors and induce cell migration in vitro. Clin Orthop Relat Res. 2015;473(5):1635–43.View ArticlePubMedPubMed CentralGoogle Scholar
- Thomas CM, Fuller CJ, Whittles CE, Sharif M. Chondrocyte death by apoptosis is associated with the initiation and severity of articular cartilage degradation. Int J Rheum Dis. 2011;14(2):191–8.View ArticlePubMedGoogle Scholar
- Ekman L, Nilsson G, Persson L, Lumsden JH. Volume of the synovia in certain joint cavities in the horse. Acta Vet Scand. 1981;22(1):23–31.PubMedGoogle Scholar