Skip to main content
  • Research article
  • Open access
  • Published:

Identification of amino acid variation in the prion protein associated with classical scrapie in Canadian dairy goats

Abstract

Background

A clear association of amino acid variation in the prion protein gene (PRNP) with susceptibility and resistance to classical scrapie exists in sheep, but not in goats. In this study we examined DNA sequence variation in the PRNP of 149 animals from two scrapie-infected herds of Saanen dairy goats, and identified 6 non-synonymous variants in the coding region.

Results

In the larger herd, all of the 54 scrapie-affected goats tested had at least one allele with the arginine (R) codon at position 211, with 52 being homozygous for that variant. No animal homozygous for the glutamine (Q) codon at 211 were affected and only two heterozygotes (R/Q) were affected. A weak association was found at position 146 and no significant associations were found with amino acid variation at the remaining four variant positions (142, 143, 222 and 240), however, the allelic variation was low. Similar patterns were observed in the second scrapie-affected herd.

Conclusion

We also evaluated previous studies on goat herds affected with scrapie and this relationship of R susceptibility and Q resistance at 211 was present independent of the genotypes at the other positions including 222. The fact that glutamine at 211 provides a significant protective property to scrapie irrespective of the other positions could be important for breeding strategies aimed at improving herd resistance to scrapie, while maintaining important productivity traits.

Background

Scrapie is a fatal neurodegenerative disease that affects sheep and goats. It is classified as a transmissible spongiform encephalopathy (TSE) belonging to a group of prion diseases, which includes Creutzfeldt-Jakob disease in humans, bovine spongiform encephalopathy (BSE) in cattle, and chronic wasting disease in cervids. Prion diseases not only have a serious impact on health and welfare, but control of these diseases impacts animal movement and trade. Prion diseases can occur sporadically as well as through heredity or infectious transmission routes [1] but pathogenesis is contingent on conversion of the normal host prion protein (PrPC) to a disease-associated form (PrPSc). In sheep and goats, scrapie is characterized by the deposition of this abnormal, protease resistant prion protein (PrPSc) in the central nervous system and peripheral tissues [2, 3]. The host prion gene (PRNP) encodes the prion protein (PrPC) and mutations within this gene have been associated with differential resistance and susceptibility to scrapie (as reviewed [4]).

Genetic resistance to scrapie is well established in sheep and three-codon PRNP genotypes have typically been utilized for risk assessment (as reviewed in [4]). The association of these three amino acid codons at positions 136, 154 and 171 produces 5 haplotypes (ARQ, VRQ, AHQ, ARR, ARH) and 15 genotypes [4, 5]. The ARR haplotype is associated with high resistance, whereas VRQ or ARQ are associated with higher susceptibility to scrapie [6, 7]. Sheep breeding programs selecting for the ARR genotype have been widely used for scrapie control and eradication programs in Europe and North America [8]. Patterns of associations to scrapie resistance and susceptibility based on the three codons used for sheep do not hold true in goats.

Although the natural occurrence of scrapie in goats appears generally lower than that in sheep, active surveillance reports suggest that the prevalence rates in goats may be underestimated in some countries [9]. There have been a number of studies that examined resistance and susceptibility to scrapie in goats from European countries (e.g., France, Italy, United Kingdom, Greece), where the goat populations are large and the incidence of scrapie has been high. These studies have characterized PRNP sequence variation in goats, and have reported a number of polymorphisms in goat populations worldwide [10–25]. In particular, thirty nine amino acid substitutions have been described, of which only six G127S [18], I142M [26], N146S/D [12], H154R [10, 12, 14, 19], R211Q [19], and Q222K [11, 14, 19] have been associated with resistance or susceptibility to scrapie in goats. At least 16 synonymous silent mutations have also been documented. To date, 39 out of the 256 codons have been shown to be polymorphic across goat breeds and generally 6 to 12 are described as polymorphic within a given goat breed. While some of the polymorphic sites are similar in sheep and goats, species-specific variation, like that observed for A136R154R171, are also present (as reviewed in [4]).

Despite the high amount of variation observed in the PRNP in various goat breeds, clear associations with scrapie susceptibility or resistance are limited. In the studies that have suggested associations with PRNP polymorphisms, the power of the analyses is often weak because of the relatively low frequencies of the putative resistant allele and the emphasis on identifying resistance alleles rather than susceptibility alleles. The unaffected animals represent a mixture of resistant and susceptible animals of varying exposure status, while the affected animals are more homogeneous in susceptibility traits. The absence of clearly identified variation, which is associated with scrapie in goats, has limited the implementation of breeding strategies to eliminate scrapie sensitive alleles in goat herds.

The objectives of this study were: (i) to identify the variation in PRNP genotypes in 2 herds of Saanen dairy goats with scrapie affected animals; (ii) to examine associations between PrPC amino acid variation and scrapie disease in the largest herd and (iii) to validate the associations using the second scrapie affected herd together with published associations.

Methods

Scrapie affected herds

The first scrapie affected dairy goat herd was composed of 331 Saanen goats greater than 12 months of age. The herd was depopulated as part of routine disease control measures following the detection and confirmation of a scrapie-positive goat. Jugular blood was sampled in EDTA-vacutainer tubes for DNA extraction and the obex and retropharyngeal lymph nodes were removed for scrapie diagnostic testing. Initial testing of obex and lymph node tissues was conducted using a commercially available ELISA (Bio-Rad TeSeE® ELISA, Bio-Rad Laboratories, Hercules, CA). Confirmatory testing was subsequently performed using immunohistochemistry with antibodies F89 and F99, and western immunoblot (Bio-Rad TeSeE® western immunoblotting kit, Bio-Rad Laboratories) as previously described [27]. An animal was considered positive for scrapie if it was positive in at least one tissue by the confirmatory tests. A total of 66 animals were found positive for classical scrapie. PRNP was sequenced for 54 of the 66 scrapie-affected and 56 of the unaffected animals.

A second, smaller scrapie-affected herd that comprised 130 Saanen goats greater than 12 months of age was also identified and subjected to depopulation. Following the testing regime described above, 13 animals were identified as classical scrapie positive. PRNP was sequenced for 10 scrapie-affected and 29 unaffected animals.

PRNP sequencing and genotyping

Genomic DNA was extracted from EDTA-preserved whole blood using the MagNa Pure DNA Isolation Kit for blood (Roche Applied Sciences) as per manufacturer’s instructions, and was quantified using PicoGreen. The Goat PRNP reference sequence was obtained from Genbank (accession # X74758) and primers were designed to amplify the ORF of PRNP (PRNP2-F: AGCTGATGCCAGTGCTATGC and PRNP4R: GTGGCCTCCTTCCAGACTTG).

PCR buffer components were in the following concentrations: 1× PCR buffer (Invitrogen), 0.2 mM of each dNTP, 1.5 mM MgCl2, 0.3 μM of forward primer, 0.3 μM of reverse primer, 0.05 U/μL of Taq DNA polymerase (Invitrogen), 10 ng of DNA and ddH2O for a total volume of 20 μl. PCR conditions used for amplification were as follows: initial denaturation at 94 °C for 5 min; [denaturation at 94 °C for 30 s, annealing at 60 °C for 1 min, extension at 72 °C for 1 min 30 s] × 35 cycles; final extension at 72 °C for 15 min; and 4 °C hold. Two μl of the amplified product were subjected to agarose gel electrophoresis to confirm amplification. PCR products were purified using ExoSAP (New England BioLabs) following the manufacturer’s instructions. BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) was used to sequence the fragments, using both the forward and reverse primers. Sequences were edited and aligned to Ovine and Caprine PRNP using MEGA™ 6.0 [28].

Analysis of genotypes in affected and unaffected samples

Comparison of the genotype frequencies of affected and unaffected groups were carried out using logistic regression models fitted to scrapie status of goats in the affected groups. When there were no positive scrapie cases, Fisher’s exact test was used.

Relative susceptibility of genotypes to scrapie

Herd 1 consisted of 331 animals more than 12 months of age and 66 tested scrapie positive; the remaining 265 animals, consisted of animals that tested scrapie negative on ELISA. The scrapie negative animals may have been exposed to the disease and not succumbed or simply may not have been exposed to the disease. In order to estimate the relative susceptibility of different genotypes to scrapie, the frequencies of alleles and genotypes in the pre-exposed herd one were estimated. We assumed the genotypes of the 56 unaffected samples that were genotyped were representative of the 209 unaffected animals that were not genotyped and the genotypes of the 54 affected animals were representative of the12 affected animals that were not genotyped. The percentages of each genotype in the pre-exposed herd that became scrapie positive were compared.

Results

PRNP variation and allele frequencies in 2 scrapie affected Ontario Saanen herds

The open reading frames of the PRNP [5] were sequenced in 54/66 of the affected animals and 56/265 of the unaffected animals. A total of eight variable sites were found, with six non-synonymous substitutions (codon positions: 142, 143, 146, 211, 222 and 240) and two synonymous substitutions (Fig. 1). Amino acids are designated by the single letter codes that give six letter alleles or haplotypes. Initially allele haplotypes were assigned based on homozygous animals; heterozygous animals were genotyped based on the confirmed alleles in the homozygotes. This left haplotype uncertainty in three of the ten alleles that were in low frequency, (Table 1) and the genotypes with those alleles (Table 2). The haplotype frequencies for each of the two herds show a high prevalence of four alleles (Table 1).

Fig. 1
figure 1

Nucleotide sequences of the eight variable sites for the ten haplotypes observed in the Ontario Saanen herds. C. hircus PRNP (genbank accession # X74758.1) was used as the reference. Synonymous substitutions are denoted in lower case

Table 1 Allele frequencies for PRNP in herds 1 and 2
Table 2 Comparison of genotypes among the complete herd, affected and unaffected animals in herd 1. Logistic regression was used to compare affected and unaffected animals

Association of variants with scrapie susceptibility

We compared the genotypes of affected and unaffected animals in order to assess the association with scrapie susceptibility using logistic regression (Table 2). The genotypes IHNRQP/IHNRQP and IHNRQS/IHNRQP, were seen in significantly higher frequency in scrapie positive animals than scrapie negative animals. Conversely, IHNQQS/IHNRQP and IHNQQS/IHNRQS were present predominantly in scrapie negative animals. Next, we examined the relative susceptibility of the different genotypes to scrapie.

We focused on the affected animals, as the unaffected sample represents a mixture of potentially resistant animals as well as unexposed or less exposed animals (Table 2). The homozygous genotype IHNRQP/IHNRQP was estimated to be present in 53 individuals in the pre-exposed herd and 16 were found in the scrapie positive sample, while the heterozygote IHNQQS/IHNRQP was estimated to be present in 67 individuals prior to exposure and only one was found in the scrapie positive samples. In order to identify the amino acids conferring scrapie susceptibility we analysed the six variable positions individually.

The genotype frequencies of the affected animals were compared to the expected frequencies based on the pre-exposed herd and the null hypothesis that the affected animals represent a random sample of genotypes in the herd (Table 3). A significant difference was found at position 211, and a weaker significance at 146. Arginine (R) at 211 was clearly associated with susceptibility while glutamine (Q) was associated with resistance in the RQ211 heterozygote. There were fewer affected animals in herd 2 but all were RR211, consistent with R being a susceptibility allele (Table 3).

Table 3 Comparison of observed and expected numbers of scrapie positive samples for each amino acid variant. Allele frequencies of the pre-exposed herd are indicated in parentheses. P-values of <0.05 are indicated in bold. Chi-square analysis was used for herd 1, and Fisher’s exact test was used for herd 2 as the sample size was low

When we examined the genotype estimates of the pre-exposed herd at position 211, the relative risk of developing the disease for the genotype RR211 and RQ211 was clear, with 64 of 182 RR211 being affected while only two of 125 RQ211 were affected. These data highlight the protective effect of Q in the heterozygote making it approximately 22 × more resistant than RR (Table 4).

Table 4 Comparison of the genotypes at position 211 to assess the relative scrapie risk

The results in Tables 3 and 4 show a clear association between R211 and scrapie susceptibility. In the literature there are reported patterns of resistance for M142, S146, R211 and K222 [11, 14, 19, 21, 29, 30], but the power of the analyses for these codons are often weak because of low allele frequencies of the proposed resistant alleles (Table 5). We examined the 544 scrapie affected samples described in the literature, and this showed most are homozygous for the proposed susceptibility alleles at positions 142, 146, 211 and 222. This is because the resistant alleles are in very low frequency in most herds in Europe and the US [11, 13, 14, 19, 21, 29, 30] and emphasises the importance of establishing the allele frequencies in the herds when associating resistance and susceptibility with genotypes. As with the data presented here, the heterozygote RQ211 is found significantly less frequently than homozygous RR211, and the QQ211 genotype was not seen in any affected animal.

Table 5 Comparison of genotypes affected with scrapie from the literature. A total of 544 scrapie cases from various breeds were assessed

Discussion

Scrapie poses a threat to the Canadian goat industry as herds on farms that test positive are entirely eradicated, and its presence limits the international export of goat genetics. Control of scrapie in sheep and goats requires knowledge of the PRNP genotypes which influence disease susceptibility. In sheep there is a clear association of amino acid variation at three positions in PRNP to susceptibility and resistance to scrapie. There are weaker associations with four positions in goats and this seems to be caused by low frequencies of variants, which in turn impact the power of the analyses. Analyses have also focused on identifying resistant alleles in unaffected animals that represent a mixture of resistant and unexposed animals. In this study, we had samples from a large herd of Saanen dairy goats with 66 affected individuals and a smaller herd with 13 affected animals.

The previous studies on goat scrapie have identified a number of variants in the different breeds and herds, which are associated with a lower incidence of scrapie [10–12, 14, 19, 26]. These include M142, S146, Q211 and K222, which were present in the two herds we examined; but apart from Q211, the frequencies of the other variants were low. However, these variants were only found in the unaffected animals in both herds.

PRNP variation in Ontario Saanens

Thirty-seven amino acid substitutions have been previously described in the open reading frame of PRNP in goats around the world. The six polymorphisms found in the Saanens from Ontario have been previously described [11, 13, 14, 19, 26]. It is usual to observe only a subset of the global goat PRNP polymorphisms in a given breed or herd. Previous studies have found polymorphic positions ranging from 5 to 14 [11, 13, 18–20]. Saanens often have six polymorphic codons, with the specific position differing among different herds in different countries. Three of the six (142, 211, and 240) were found in Italian Saanens; four (142, 211, 222 and 240) were found in the French and Spanish Saanens. The remaining two polymorphic codons 143 and 146 that were seen in low allele frequencies (0.34 and 5 %, respectively), have been reported in Saanens crossbred with Hellenic and Damascus breeds, respectively [10, 12, 24]. As the Saanen breed originated from Switzerland, these similarities and differences are the result of founder effects combined with cross breeding with local goat breeds.

Of the ten haplotypes found in this study, three (IHNRQP, IHNRQS and IHNQQS) were present in 90 % of the sampled animals. The two major PRNP haplotypes (IHNRQP and IHNRQS) differed from one another by the presence of proline (P) or serine (S) at position 240. In both of the herds investigated, P240 was slightly higher in frequency (55 %) compared to S240 (45 %). This pattern has been noted in French Saanens [19, 21], Italian [11, 14], Spanish [20], British [18]; North American [13] and Greek goats [10, 23, 29, 30]. When we estimated the haplotype and genotype frequencies for all the animals in both herds, comparable trends were observed for the two main haplotypes (IHNRQP and IHNRQS); however, for the other haplotypes present in low frequencies, significant differences were present between the two herds. Low haplotypic frequencies are usually encountered when examining PRNP variation in goat herds [10, 11, 14, 19–21, 23].

PRNP variants associated with scrapie susceptibility

When we compared the genotypes of affected and unaffected animals, we found two genotypes to be associated with scrapie susceptibility and two to be associated with resistance. Specifically, we compared the estimated allele and genotype frequencies of the herd prior to exposure with those of affected animals. Of the six variable positions, two (146 and 211) had genotype frequencies significantly different in the affected samples than those expected from the pre-exposed frequencies. There was weak significance for position 146 and similar results have been found in other studies, where the homozygous NN146 genotype has been associated with scrapie susceptibility in Cypriot goats [16, 24]. The homozygous RR211 genotype was strongly associated with scrapie susceptibility, with the heterozygous RQ211 genotype conferring a degree of protection to the disease.

Effect of position 211 on scrapie susceptibility and resistance

All the affected animals from herd 1 had at least one allele with arginine (R) at position 211. Specifically, of the 54 affected samples tested, 52 were RR211, whereas, the remaining 2 were RQ211. In the unaffected group, RR211 was seen in 25 of the 56 samples and RQ211 and QQ211 were seen in 26 and 5 animals, respectively. A similar result was seen in the second herd where all the affected samples were RR211. These findings indicate that glutamine (Q) at position 211 confers protection to scrapie. The frequency of Q is usually low and therefore the homozygous QQ211 is seen in very low frequency in most herds, however it has not been seen any of the affected animals reported in the literature (Table 5).

Significant differences between the frequencies of the RQ211 in the unaffected samples compared to the affected samples shows heterozygous goats have a significantly lower susceptibility to scrapie than RR211 individuals. A comparison of the estimated genotypes of the herd prior to scrapie exposure to the affected animals shows 35 % of the homozygous RR211 individuals developed the disease, whereas only 1.6 % of the heterozygous RQ211 individuals succumbed. Similar patterns have been reported in the literature. In French goat populations, the risk of succumbing to scrapie for RR211 and RQ211 to be 30–39 % and 4.4–14 %, respectively [19, 21]. These results highlight the protection provided by the glutamine (Q) at position 211 and low prevalence of the disease in the heterozygous animals.

Although additional studies are required, it is interesting to compare the 211 variant position in goats to position 171, of the A136R154Q171 allele in sheep. In sheep, homozygous ARR is considered resistant and homozygous ARQ is susceptible; whereas ARR/ARQ heterozygous sheep are relatively resistant to scrapie [7, 31]. Similar results were found in this study where homozygous QQ211 and RR211 were found resistant and highly susceptible respectively, while there was a very low prevalence of scrapie in RQ211 heterozygous animals. Although, scrapie has not been seen in Canadian ARR/ARQ sheep to date, it has been detected in Europe sheep [31–33]. Statistical models have estimated that genotypes with ARR haplotypes were 1000× more resistant to the disease compared to homozygous ARQ [33, 34]. In this study we estimated RQ211 were 22 × more resistant than homozygous RR211, suggesting that RQ171 in sheep has a stronger influence on resistance than RQ211 in goats. Similar to homozygous ARR sheep, the QQ211 genotype in goats is seen in relatively low frequency [31–33].

Although the mechanism for the conversion of PrPC to the pathogenic form (PrPSc) and its pathological effects are poorly understood, specific mutations in sheep PRNP associated with resistance are shown to destabilize the PrPC protein [35]. Direct correlation of scrapie susceptibility and mutation induced changes are unlikely as the structural consequence of scrapie associated variants are local. As such, variations in scrapie susceptibility are likely caused by altering protein stability. Destabilizing the structure of PrPC may increase protease sensitivity and slow amyloidogenesis, thereby preventing PrPC from being converted to the pathogenic form. This is thought to account for the change from scrapie susceptibility to resistance following a single amino acid substitution (ARQ171 to ARR171) in sheep [36], and perhaps also the inhibition of cell-free conversion following the substitution of R to Q at codon 211 in recombinant goat PrP [37].

Position 211 and developing scrapie resistant dairy goat herds in Ontario

An association of other variants (M142, S146 and K222) with protection towards scrapie was not tested in this study due to low allele frequencies of the potentially resistant allele. QQ211 provided protection regardless of the amino acids at the other positions such as 222. There is a suggestion from challenge studies that K222 may confer more resistance than Q211 [22]. In preliminary studies on Ontario dairy goat herds, the frequency of K222 has been found to be very low or absent, making elimination of Q222 very difficult. The extent to which elimination of R211 could result in scrapie resistant herds is of great interest and additional studies on surveying genotype frequencies in Ontario dairy herds are underway.

Conclusions

The data presented, highlights the association of arginine (R) at position 211 with susceptibility to scrapie and the protective effect of Q, irrespective of the amino acids at the other positions. To date there are no programs in place in Canada to select for resistance towards scrapie in goats. A major barrier may be the low frequency of scrapie resistant animals in Canadian goat herds. As the male to female ratio in breeding programs is often 1:20, the genotype of the bucks has a strong impact on the determination of the overall genetic profile of the herd. The most efficient strategy to select against high risk animals, at the same time minimizing the loss of production traits, would be to only utilize more resistant bucks or semen. This would be a particularly useful approach for goat producers associated with a farm previously infected with scrapie, and goat producers providing large numbers of breeding ewes to other producers.

In sheep, breeding for scrapie resistant with ARR/ARR rams has been a successful strategy for the prevention of scrapie outbreaks [38]. Furthermore, increased frequencies of the resistance associated ARR allele, as a result of selective breeding, is assumed to have a population effect by reducing the scrapie infection risk even for animals of susceptible genotypes [8, 39]. As the protection provided by R171 in heterozygous sheep seems to be several folds higher than the protection provided by Q211 in heterozygous goats, selection for homozygous QQ211 goats should be favoured. Breeding for resistance in goats by recruiting bucks with scrapie-resistant genetics, should increase the frequency of resistant alleles in the herd, with a resultant reduction in classical scrapie susceptibility.

References

  1. Prusiner S. Prions. Proc Natl Acad Sci U S A. 1998;95:13363–83.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  2. Andreoletti O, Berthon P, Marc D, Sarradin P, Grosclaude J, van Keulen L, Schelcher F, Elsen JM, Lantier F. Early accumulation of PrPSc in gut-associated lymphoid and nervous tissues of susceptible sheep from a Romanov flock with natural scrapie. J Gen Virol. 2000;81:3115–26.

    Article  CAS  PubMed  Google Scholar 

  3. Gonzalez L, Martin S, Siso S, Konold T, Ortiz-Pelaez A, Phelan L, Goldmann W. Stewart P. Saunders G. et al. High prevalence of scrapie in a dairy goat herd: tissue distribution of disease-associated PrP and effect of PRNP genotype and age. Vet Res. 2009;40:65.

    Article  PubMed  Google Scholar 

  4. Goldmann W. PrP genetics in ruminant transmissible spongiform encephalopathies. Vet Res. 2008;39:30.

    Article  PubMed  Google Scholar 

  5. Goldmann W, Hunter N, Foster JD, Salbaum JM, Beyreuther K, Hope J. Two alleles of a neural protein gene linked to scrapie in sheep. Proc Natl Acad Sci U S A. 1990;87(7):2476–80.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  6. Baylis M, Goldmann W. The genetics of scrapie in sheep and goats. Curr Mol Med. 2004;4:385–96.

    Article  CAS  PubMed  Google Scholar 

  7. Harrington NP, O'Rourke KI, Feng Y, Rendulich J, DiFruscio C, Balachandran A. Prion genotypes of scrapie-infected canadian sheep 1998–2008. Canadian Journal of Veterinary Research-Revue Canadienne De Recherche Veterinaire. 2010;74:228–32.

    CAS  PubMed  PubMed Central  Google Scholar 

  8. European Food Safety Authority. Scientific Opinion on the scrapie situation in the EU after 10 years of monitoring and control in sheep and goats. EFSA Panel on Biological Hazards. EFSA Journal. 2014;12(7):3781.

    Google Scholar 

  9. Vaccari G, Panagiotidis CH, Acin C, Peletto S, Barillet F, Acutis P, Bossers A, Langeveld J, van Keulen L. et al. State-of-the-art review of goat TSE in the european union, with special emphasis on PRNP genetics and epidemiology. Vet Res. 2009;40:48.

    Article  PubMed  PubMed Central  Google Scholar 

  10. Billinis C, Panagiotidis C, Psychas V, Argyroudis S, Nicolaou A, Leontides S, Papadopoulos O, Sklaviadis T. Prion protein gene polymorphisms in natural goat scrapie. J Gen Virol. 2002;83:713–21.

    Article  CAS  PubMed  Google Scholar 

  11. Acutis P, Bossers A, Priem J, Riina M, Peletto S, Mazza M, Casalone C, Forloni G, Ru G, Caramelli M, et al. Identification of prion protein gene polymorphisms in goats from italian scrapie outbreaks. J Gen Virol. 2006;87:1029–33.

  12. Papasavva-Stylianou P, Kleanthous M, Toumazos P, Mavrikiou P, Loucaides P. Novel polymorphisms at codons 146 and 151 in the prion protein gene of cyprus goats, and their association with natural scrapie. Vet J. 2007;173:459–62.

    Article  CAS  PubMed  Google Scholar 

  13. White S, Herrmann-Hoesing L, O'Rourke K, Waldron D, Rowe J, Alverson J. Prion gene (PRNP) haplotype variation in united states goat breeds (open access publication). Genet Sel Evol. 2008;40:553–61.

    CAS  PubMed  PubMed Central  Google Scholar 

  14. Vaccari G, Di Bari M, Morelli L, Nonno R, Chiappini B, Antonucci G, Marcon S, Esposito E, Fazzi P. et al. Identification of an allelic variant of the goat PrP gene associated with resistance to scrapie. J Gen Virol. 2006;87:1395–402.

    Article  CAS  PubMed  Google Scholar 

  15. Serrano C, Hammouchi M, Benomar A, Lyahyai J, Ranera B, Acin C, el Hamidi M, Monzon M, Badiola J. J. et al. PRNP haplotype distribution in moroccan goats. Anim Genet. 2009;40:565–8.

    Article  CAS  PubMed  Google Scholar 

  16. Papasavva-Stylianou P, Windl O, Saunders G, Mavrikiou P, Toumazos P, Kakoyiannis C. PrP gene polymorphisms in cyprus goats and their association with resistance or susceptibility to natural scrapie. Vet J. 2011;187:245–50.

    Article  CAS  PubMed  Google Scholar 

  17. Hussain A, Babar ME, Imran M, Haq IU, Javed MM. Detection of four novel polymorphisms in PrP gene of pakistani sheep (damani and hashtnagri) and goats (kamori and local hairy) breeds. Virol J. 2011;8:246.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  18. Goldmann W, Ryan K, Stewart P, Parnham D, Xicohtencatl R, Fernandez N, Saunders G, Windl O, Gonzalez L, Bossers A, Foster J, et al. Caprine prion gene polymorphisms are associated with decreased incidence of classical scrapie in goat herds in the united kingdom. Vet Res. 2011;42:110.

  19. Barillet F, Mariat D, Amigues Y, Faugeras R, Caillat H, Moazami-Goudarzi K, Rupp R, Babilliot J. M, Lacroux C, et al. Identification of seven haplotypes of the caprine PrP gene at codons 127, 142, 154, 211, 222 and 240 in french alpine and saanen breeds and their association with classical scrapie. J Gen Virol. 2009;90:769–76.

    Article  CAS  PubMed  Google Scholar 

  20. Acin C, Martin-Burriel I, Monleon E, Lyahyai J, Luis Pitarch J, Serrano C, Monzon M, Zaragoza P, Jose Badiola J, et al. Prion protein gene variability in Spanish goats. Inference through susceptibility to classical scrapie strains and pathogenic distribution of peripheral PrPsc. Plos One. 2013;8, e61118.

  21. Corbiere F, Perrin-Chauvineau C, Lacroux C, Costes P, Thomas M, Bremaud I, Martin S, Lugan S, Chartier C. et al. PrP-associated resistance to scrapie in five highly infected goat herds. J Gen Virol. 2013;94:241–5.

    Article  CAS  PubMed  Google Scholar 

  22. Lacroux C, Perrin-Chauvineau C, Corbiere F, Aron N, Aguilar-Calvo P, Maria Torres J, Costes P, Bremaud I, Lugan S. et al. Genetic resistance to scrapie infection in experimentally challenged goats. J Virol. 2014;88:2406–13.

    Article  PubMed  PubMed Central  Google Scholar 

  23. Kanata E, Humphreys-Panagiotidis C, Giadinis ND, Papaioannou N, Arsenakis M, Sklaviadis T. Perspectives of a scrapie resistance breeding scheme targeting Q211, S146 and K222 caprine PRNP alleles in greek goats. Vet Res. 2014;45:43.

    Article  PubMed  PubMed Central  Google Scholar 

  24. Ortiz-Pelaez A, Georgiadou S, Simmons MM, Windl O, Dawson M, Arnold ME, M. E, Neocleous P, Papasavva-Stylianou P, et al. Allelic variants at codon 146 in the PRNP gene show significant differences in the risk for natural scrapie in cypriot goats. Prion. 2014;8:65–6.

  25. Aguilar-Calvo P, Andreoletti O, Fast C, Espinosa J, Lacroux C, Groschup MH, H, Maria Torres J, et al. Influence of prnp variants on the susceptibility of goats to scrapie and BSE. Prion. 2014;8:15–6.

  26. Goldmann W, Martin T, Foster J, Hughes S, Smith G, Hughes K, Dawson M, Hunter N, et al. Novel polymorphisms in the caprine PrP gene: a codon 142 mutation associated with scrapie incubation period. J Gen Virol. 1996;77:2885–91.

  27. Mitchell GB, O'Rourke KI, Harrington NP, Soutyrine A, Simmons MM, Dudas S, Zhuang D, Laude H, Balachandran A, et al. Identification of atypical scrapie in Canadian sheep. J Vet Diagn Invest. 2010;22:408–11.

  28. Tamura K, Dudley J, Nei M, Kumar S. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol. 2007;24:1596–9.

  29. Bouzalas IG, Dovas CI, Banos G, Papanastasopoulou M, Kritas S, Oevermann A, Papakostaki D, Evangelia C, Papadopoulos O, Seuberlich T, Koptopoulos G, et al. Caprine PRNP polymorphisms at codons 171, 211, 222 and 240 in a Greek herd and their association with classical scrapie. J Gen Virol. 2010;91:1629–34.

  30. Fragkiadaki EG, Vaccari G, Ekateriniadou LV, Agrimi U, Giadinis ND, Chiappini B, Esposito E, Conte M, Nonno R, et al. PRNP genetic variability and molecular typing of natural goat scrapie isolates in a high number of infected flocks. Vet Res. 2011;42:104.

  31. Baylis M, Chihota C, Stevenson E, Goldmann W, Smith A, Sivam K, Tongue S, Gravenor M, et al. Risk of scrapie in British sheep of different prion protein genotype. J Gen Virol. 2004;85:2735–40.

  32. Tongue SC, Pfeiffer DU, Warner R, Elliott H, Vilas VD. Estimation of the relative risk of developing clinical scrapie: the role of prion protein (PrP) genotype and selection bias. Vet Rec. 2006;158:43.

    Article  CAS  PubMed  Google Scholar 

  33. Arnold M, Ortiz-Pelaez A. The evolution of the prevalence of classical scrapie in sheep in great Britain using surveillance data between 2005 and 2012. Prev Vet Med. 2014;117:242–50.

    Article  PubMed  Google Scholar 

  34. Dubois MA, Sabatier P, Durand B, Calavas D, Ducrot C, Chalvet-Monfray K. Multiplicative genetic effects in scrapie disease susceptibility. C R Biol. 2002;325:565–70.

    Article  PubMed  Google Scholar 

  35. Rezaei H, Choiset Y, Eghiaian F, Treguer E, Mentre P, Debey P, Grosclaude J, Haertle T, et al. Amyloidogenic unfolding intermediates differentiate sheep prion protein variants. J Mol Biol. 2002;322:799–814.

  36. Eghiaian F, Grosclaude J, Lesceu S, Debey P, Doublet B, Treguer E, Rezaei H, Knossow M, et al. Insight into the PrPC-> PrPSc conversion from the structures of antibody-bound ovine prion scrapie-susceptibility variants. Proc Natl Acad Sci U S A. 2004;101:10254–9.

  37. Eiden M, Soto EO, Mettenleiter TC, Groschup MH. Effects of polymorphisms in ovine and caprine prion protein alleles on cell-free conversion. Vet Res. 2011;42:30.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  38. Nodelijk G, van Roermund HJW, van Keulen LJM, Engel B, Vellema P, Hagenaars TJ. Breeding with resistant rams leads to rapid control of classical scrapie in affected sheep flocks. Vet Res. 2011;42:5.

    Article  PubMed  PubMed Central  Google Scholar 

  39. Hagenaars TJ, Melchior MB, Bossers A, Davidse A, Engel B, van Zijderveld FG. Scrapie prevalence in sheep of susceptible genotype is declining in a population subject to breeding for resistance. BMC Vet Res. 2010;6:25.

    Article  PubMed  PubMed Central  Google Scholar 

Download references

Acknowledgments

The authors acknowledge the support staff in the Transmissible Spongiform Encephalopathy Unit at the CFIA Ottawa Laboratory Fallowfield for outstanding technical assistance, and the CFIA Operations staff involved in sample collection. We thank members of the Natural Resources DNA Profiling and Forensic Center, in particular Nguyen Thi Xuan Nguyen, for assistance with the scrapie genotyping.

Author information

Authors and Affiliations

Authors

Corresponding author

Correspondence to Vythegi Srithayakumar.

Additional information

Competing interests

The author(s) declare that they have no competing interests.

Authors’ contribution

VS carried out the laboratory work, conducted the analyses and drafted the manuscript. GBM provided the samples for this study and helped draft the manuscript. BNW played a critical role in project development, manuscript preparation and obtained the funding to carry out this research. All the authors edited and approved the manuscript prior to submission.

Rights and permissions

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Srithayakumar, V., Mitchell, G.B. & White, B.N. Identification of amino acid variation in the prion protein associated with classical scrapie in Canadian dairy goats. BMC Vet Res 12, 59 (2016). https://doi.org/10.1186/s12917-016-0684-x

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12917-016-0684-x

Keywords