Skip to content

Advertisement

You're viewing the new version of our site. Please leave us feedback.

Learn more

BMC Veterinary Research

Open Access

PCR melting profile as a tool for outbreak studies of Salmonella enterica in chickens

  • Anna Zaczek1,
  • Arkadiusz Wojtasik2,
  • Radosław Izdebski3,
  • Elzbieta Gorecka2,
  • Ewelina A. Wojcik2,
  • Tomasz Nowak4,
  • Piotr Kwiecinski4 and
  • Jaroslaw Dziadek5Email author
BMC Veterinary Research201511:137

https://doi.org/10.1186/s12917-015-0451-4

Received: 15 March 2015

Accepted: 8 June 2015

Published: 23 June 2015

Abstract

Background

Salmonellosis is of great economic concern in all phases of the poultry industry, from production to marketing, leading to severe economic losses. Monitoring the source of the bacterial contamination has fundamental importance in the spreading of salmonellosis.

Results

We applied a ligation-mediated PCR method, PCR MP (PCR melting profile), to type S. enterica ssp. enterica ser. Enteritidis (56 strains) and 43 control strains classified to other serovars isolated from poultry. We demonstrated the PCR MP potential for salmonellosis spreading monitoring. Our rapid test presents higher discriminatory power (0.939 vs. 0.608) compared to current molecular subtyping tool such as pulsed-field gel electrophoresis (PFGE), which ineffectiveness underlies the high degree of clonality of S. Enteritidis.

Conclusions

PCR MP was found to be a highly discriminating, sensitive and specific method that could be a valuable molecular tool, particularly for analyzing epidemiological links of limited number of S. enterica ser. Enteritidis strains.

Keywords

PCR MP Salmonella differentiationInfection outbreak monitoring

Background

According to the most recent nomenclature adopted by the Centers for Disease Control (CDC), the genus Salmonella contains only two species, Salmonella enterica and Salmonella bongori. S. enterica is subdivided into six subspecies designated as follows: enterica (I), salamae (II), arizonae (IIIa), diarizonae (IIIb), houtenae (IV), and indica (VI), while S. bongori is not divided into subspecies. Both Salmonella species and subspecies are serotyped for further identification [1].

Salmonella enterica is a major cause of invasive infections and represents an important human and animal pathogen worldwide.

Non-typhoidal serovars of S. enterica can infect a broad range of domestic animals and cause different symptoms, ranging from gastroenteritis to death [2]. Some of these serovars, such as S. Typhimurium and S. Enteritidis, can infect animals and humans [3]. Salmonella outbreaks in humans are often associated with poultry and poultry products, which are considered reservoirs from which Salmonella is passed through the food chain and ultimately transmitted to humans [4]. Other serovars, such as S. Gallinarum and S. Pullorum in poultry, are host specific, infecting a single species and generally causing severe, typhoid-like symptoms leading to death [5]. In chickens, enteric disease caused by S. enterica is an important cause of mortality and morbidity. Monitoring of these bacteria, which may be associated with foodborne diseases in humans, is one of the great objectives of the poultry industry, since salmonellosis leads to severe economic losses.

An important challenge for the eradication of Salmonella is the development and implementation of rapid and affordable methods for the detection and characterization of this pathogen.

Although phenotyping approaches, such as serotyping or phage typing, are still commonly used in the investigation of Salmonella infections worldwide, these methods are most useful as preliminary tools for Salmonella classification. More efficient and precise molecular subtyping methods are needed to relate disease-causing pathogens to their probable sources and determine whether isolates from multiple, even widely dispersed, cases of salmonellosis are related [6].

Currently, pulsed-field gel electrophoresis (PFGE) is considered as the standard typing method for Salmonella outbreak investigations suitable for examining epidemiologically related strains. PFGE was adapted to Salmonella in the 1990s and was shown to have the capacity to identify strains at the origin of an outbreak [7, 8]. However, PFGE often may not be able to differentiate highly clonal strains [9, 10]. Moreover, PFGE is a time consuming and highly laborious method which can be performed only in reference laboratories.

Recently, several genotyping methods, such as MLST (multilocus sequence typing based on housekeeping genes), SNP, MLVA (multiple-locus VNTR analysis), MAPLT (multiple amplification of phage locus typing) and WGS (whole-genome sequencing) using NGS methods (next-generation sequencing) to identify subtypes by whole-genome comparisons, have been applied to analyze Salmonella strains [6, 11]. MLST appeared to be valuable for differentiating the major sublineages of Salmonella, so the molecular typing of Salmonella has been often performed based on variants of MLST [1215]. WGS data are able to provide more accurate phylogenetic relationship than the small sets of genes used in MLST [11]. More recently, investigations of outbreaks are often based on MLVA, which generates reproducible results suitable for sharing between laboratories using the same standardized techniques [1618]. MLVA appears to be as informative as WGS to determine the true underlying genetic relationships within S. Typhimurium [18]. However all of this methods require specialized equipment and analyses which are too expensive from the farmers point of view.

An interesting alternative to the methods mentioned above is the PCR melting profile (PCR MP) technique based on ligation-mediated PCR (LM-PCR), which has been useful in epidemiological analyses of a number of organisms. This technique was developed by Masny and Plucienniczak [19] and modified by Krawczyk et al. [20] for bacterial strain differentiation. To date, the PCR MP method has been successfully used for analyses of different strains of bacteria, such as Escherichia coli, Klebsiella pneumoniae, Staphylococcus aureus, Enterococcus faecium, Clostridium difficile, Pseudomonas aeruginosa, Propionibacterium acnes, as well as dermatophytes and yeast (Candida) [21, 22].

In this study, we adapted PCR MP to Salmonella for the first time. We found PCR MP useful in respect to discriminate closely related strains isolated at the same farm (different stables) or different farms served by the same hatchery. The utility of the PCR MP approach was evaluated by comparison of the results with data obtained using the PFGE method.

Methods

Bacterial strains

Ninety-nine S. enterica ssp. enterica strains were used in this study. In total, 56 strains of S. enterica ssp. enterica ser. Enteritidis (S. Enteritidis), 6 strains of S. Virchow, 1 strain of S. Senftenberg, 10 strains of S. Typhimurium, 5 strains of S. Infantis, 2 strains of S. Hadar, and 5 strains of S. Mbandaka were isolated from chickens and environmental samples by a veterinary diagnostic laboratory according to a National program for the control of certain Salmonella serotypes (Vet-Lab Brudzew, central Poland). All procedures were approved by Polish Centre for Accreditation on 18 July 2008 (Accreditation No. AB 924) and by the Chief Veterinary Officer Decision No. GIWhig-5120-23/08 on 24 October 2008. All strains were classified according to their growth requirements, colony morphology and biochemical characteristics and serotypes using ISO 6579:2002 (E) (Microbiology of food and animal feeding stuffs - Horizontal method for the detection of Salmonella spp.)

The S. Berta, S. Colindale, S. Derby, S. Enteritidis, S. Heidelberg, S. Moscow, and S. Virchow control strains were obtained from the museum collection of National Veterinary Research Institute PIWet Pulawy (animal origin), and the S. Brandenburg, S. Enteritidis (2), S. Hadar, S. Paratyphi, and S. Typhimurium (2) control strains were obtained from the Sanepid sanitary-epidemiological station in Lodz. All strains were cultured in LB medium (10 g/L trypton, 5 g/L yeast extract, 10 g/L NaCl, pH 7.0) for 20 h at 37°C.

DNA extraction

The genomic DNA was extracted from each strain after overnight culture on LB agar using the Genomic Mini system (A&A Biotechnology). The DNA in the samples was quantified using an ND-1000 Spectrophotometer (NanoDrop Technologies Inc., USA).

PCR MP

The PCR MP procedure, which was initially developed for the differentiation of Escherichia coli [20], was based on the digestion of genomic DNA with restriction enzymes and the ligation of the obtained DNA restriction fragments with an oligonucleotide adaptor followed by PCR amplification with a reduction of the denaturation temperature during each cycle.

The PCR MP procedure was optimized for Salmonella spp. In this study, we digested genomic DNA (about 0.5 μg) by incubating a mixture containing 10 U of HindIII (1.0 μl) (Fast Digest; Fermentas, Lithuania) and 2.0 μl of reaction buffer in a total volume of 20 μl at 37 °C for 15 min. Next, the digested genomic DNA was ligated to the adaptor (1 μM) using 0.5 U of T4 ligase and 2.5 μl of 1x ligation buffer (Fermentas) in a total volume of 25 μl for 1 h at 25 °C. The adaptor was prepared by mixing equimolar amounts of two oligonucleotides: pcr/mp-oligo-ligCTCACTCTCACCAACGTCGAC, and oli-pom-HindIII AGCTGTCGACGTTGG (Eurogentec, Belgium) dissolved in 100 μl water to a final concentration of 10 μM and incubated for 2 min at 60 °C. After ligation of the digested genomic DNA with the adaptor, the mixture was heated in a thermo-block at 70 °C for 10 min and then cooled. A total of 1 μl of this mixture was amplified by PCR (Verity thermocycler; Applied Biosystems, USA) in a reaction mixture consisting of 20 pmol of primer (pcr/mp-starter-Hind: CTCACTCTCACCAACGTCGACAGCTT), 1x PCR buffer Shark (200 μM Tris–HCl pH 8.8, 100 mM KCl, 100 mM (NH4)2SO4, 1 % Triton X-100, DNA Gdańsk), 1.5 mM MgCl2, 0.8 mM nucleoside triphosphates, and 1 U of Pwo polymerase Hypernova (DNA Gdańsk II, Poland) in a total volume of 25 μl. The denaturation temperature was determined during the optimization experiments for two genetically unrelated S. enterica strains using a gradient thermal cycler (Biometra, T-Gradient) with a gradient range of 83.5 – 88.5 °C for the denaturation step. The PCRs were performed as follows: 7 min at 72 °C; an initial denaturation step for 90 s over a gradient of 83.5 – 88.5 °C; 22 cycles of denaturation for 1 min at a gradient of 83.5 – 88.5 °C followed by annealing and elongation at 72 °C for 2 min 15 s; and a final elongation step at 72 °C for 5 min. For all isolates of Salmonella, the PCRs were performed at least three times as described above using the established optimal temperature of 85.7 °C.

Each PCR product (8 μl) was run on a 6 % polyacrylamide gel (AppliChem, Germany), and the amplification patterns were determined by examination on ethidium bromide (0.7 %)-stained gels illuminated by UV light (Alpha Innotech, Fc8800). The amplicon sizes were determined by comparing the bands with a 100-bp DNA mass ladder (Fermentas). Electrophoresis images were collected. The total procedure of PCR-MP was completed within 5 h.

Eight independent PCR MP reactions were conducted for S. Enteritidis 571 and S. Typhimurium 1751 to confirm the repeatability of the method.

PFGE

Pulsed-field gel electrophoresis (PFGE) was performed as described [23] with the use of the XbaI restriction enzyme (Fermentas, Vilnius, Lithuania). The PFGE types and subtypes were discerned visually according to the criteria by Tenover et al. [24].

Data analysis

Epidemiological data were analyzed using the BioNumerics package (Version 6.01, Applied Maths, Sint-Martens-Latem, Belgium) based on images of PCR MP electrophoretic band patterns obtained for the entire collection of strains. Dendrograms were generated with BioNumerics software using the Dice similarity coefficient and clustering by the unweighted pair group method with arithmetic mean (UPGMA), with 1 % tolerance for differences in the band position. A cluster was defined here as all isolates sharing the same pattern. The Hunter-Gaston discriminatory index (HGDI) was calculated as described previously [25], and it was used to evaluate the discriminatory power of the typing methods.

Results

Population structure in PFGE genotyping

A collection of 99 S. enterica subsp. enterica strains was used for genotyping using the PFGE method. As can be clearly seen in figure (Fig. 1), it was possible to identify 10 clusters comprising approximately 75 % of the strains, whereas the remaining 25 patterns were unique and accordingly defined as singletons. Particularly, the most numerous serovar, S. Enteritidis, was divided into 1 small (PFGE-E1) and 2 large clusters (PFGE-E2 and PFGE-E3), which included 3, 32 and 19 strains, respectively. Only 5 patterns were recognized as unique; of these 5 strains, 3 displayed a high similarity to clustered strains, whereas the profiles of strains the KK14 and WK-6 were completely unique. The S. Typhimurium group (12 strains) was characterized by 3 singletons and 2 clusters (PFGE-T1 and PFGE-T2) with 6 and 3 strains included, respectively. For S. Virchow (7 strains), with the exception of 3 singletons, 2 clusters (PFGE-V1 and PFGE-V2/E) were identified. The second of these was surprisingly composed of 2 S. Virchow strains (394 and PK0) and, separately, strain WK-6 of the S. Enteritidis group. The serovar Mbandaka (5 strains) was distributed among 2 clusters (PFGE-M1 and PFGE-M2), and Infantis (5 strains) had 3 unique band profiles and 1 cluster (PFGE-I). Three S. Hadar strains and the remaining single representatives of the different serovars were categorized as singletons.
Fig. 1

Differentiation of a collection of 99 S. enterica ssp. enterica strains by PFGE method. Genetic relationships among collection of S. enterica strains based on PFGE patterns. The serovars and strain numbers are indicated on the right of the band patterns. The similarity among strains, as a percentage, is indicated above the dendrogram. Strains grouped in clusters are framed. The tree was generated using the Dice correlation and unweighted pair group, as described in Methods

Population structure by PCR MP genotyping

After the repeatability of the PCR MP method confirmation based on eight independent reactions conducted for S. Enteritidis 571 and S. Typhimurium 1751 all 99 of the analyzed isolates were typeable using the PCR MP approach. Based on the genotyping results, 38 unique patterns and 22 clusters containing low numbers of isolates comprised approximately 62 % of the strains (Fig. 2). In the case of the S. Enteritidis set, PCR MP differentiated up to 19 singletons and 14 small clusters (from MP-E1 to MP-E14), including strains in number of 2 to 6. In contrast to the PFGE, patterns that differed substantially from the S. Enteritidis group were not detected. Using the PCR MP method, it was possible to generate 3 clusters (from MP-T1 to MP-T3) for the S. Typhimurium strains, whereas 4 patterns of this serovar displayed unique profiles. Among the S. Virchow collection, 3 strains had different band profiles, and the 4 remaining strains clustered together (MP-V). In contrast to the PFGE results, no similarity was found in the profile between the S. Virchow strains (394 and PK0) and S. Enteritidis WK-6. A group of S. Mbandaka strains revealed the same cluster that was detected by PFGE (MP-M), whereas the profiles of the 2 remaining strains were found to be different. On the contrary, in the case of S. Hadar, two of three strains were clustered (MP-H) according to the PCR MP results. Strains belonging to the S. Infantis serovar were distributed among 2 clusters (MP-I1 and MP-I2), and one pattern appeared to be a singleton. As expected, all single representatives of different serovars were found to be singletons.
Fig. 2

Differentiation of a collection of 99 S. enterica ssp. enterica strains by PCR MP method. Genetic relationships among collection of S. enterica strains based on PCR MP profiles. The serovars and strain numbers are indicated on the right of the band patterns. The similarity among strains, as a percentage, is indicated above the dendrogram. Strains grouped in clusters are framed. The tree was generated using the Dice correlation and unweighted pair group, as described in Methods

Comparison of the strain discrimination potential of the PFGE and PCR MP methods regarding the S. Enteritidis serovar

The more detailed comparison of the two methods was implemented for the S. Enteritidis collection due to the number of strains in the analyzed population. The PCR MP typing approach displayed higher differentiating power than the reference method, reaching discriminatory index (HGDI) of 0.939 in comparison to 0.608. Additionally, the intrinsically lower numbers of bands in the PFGE patterns might contribute to the moderately lower resolution of this method compared with PCR MP genotyping. A cross-classification pattern for the clustered strains determined using both methods is shown to provide a more clear depiction of the relationship (Table 1). When taking into consideration two large PFGE-E clusters, it is clearly demonstrated that strains from both of these clusters were almost regularly distributed among the MP-E types as well as differentiated as singletons. However, it is worth mentioning that 3 of 5 singletons generated by PFGE were clustered with other strains identified using the PCR MP approach, and they could not be differentiated by PCR MP typing alone. This outcome strongly suggested that PFGE could serve as reasonable complementary approach during a detailed epidemiological analysis.
Table 1

Discrimination potential of the PFGE and PCR MP regarding 56 S. Enteritidis strains

 

MP-E cluster

1

2

3

4

5

6

7

8

9

10

11

12

13

14

singleton

total

PFGE-E cluster

1

     

1

        

2

3

2

   

1

2

4

2

2

1

3

3

2

3

2

7

32

3

2

2

2

2

   

1

1

   

1

 

8

19

singleton

  

1

  

1

  

1

     

2

5

total

2

2

3

3

2

6

2

3

3

3

3

2

4

2

19

59

Epidemiological links

All 99 analyzed S. enterica ssp. enterica strains were grouped into MP clusters, as shown above. Some clusters, such as MP-E1 and MP-E4, a portion of MP-E6, MP-E9, and MP-E12, and a portion of MP-E13, MP-V, MP-I2, and MP-M, were composed of strains isolated from poultry hatched in the same hatchery and bred at the same or similar time on farms belonging to the same farmer (Table 2). Other clusters, such as MP-E2, MP-E4, MP-E9, MP-E11, MP-T3, and MP-I1, originated from the same hatchery, which indicates that the hatchery was the source of Salmonella infection. It was also observed that the Salmonella strains infecting broiler chickens were isolated from coops belonging to the same farmer. In this case, the source of Salmonella infection was the farmer and not the hatchery (S. Mbandaka 913/S/09 and MP-M). Some isolates originating from chickens hatched in the same hatchery and bred by the same farmer did not group within the same clusters (MP-E1 and S. Enteritidis 1014/S/09 K1; MP-E4 and S. Enteritidis 1044/S/09 K2). In this case, the Salmonella strains were isolated from chickens bred in different batches or during different periods of time (Table 2).
Table 2

Epidemiological data of 99 S. enterica ssp. enterica strains used in study

Serovar

MP Cluster

Strain

Source: farm/isolation date

Epidemiological links

    

Farmer

Hatchery

Kind of poultry/Sample

Coexistence

Enteritidis

 

838/S/09 B

Konin/16.06.2009

F1

H1

(CL)

E

  

1445/S/09 K46

Poddębice/25.08.2009

F1

H1

(CL)

L

 

MP-E1

1067/S/09 K2

Brodnica/13.07.2009

F5

H4

(CL)

K

  

1067/S/09 K3

Brodnica/13.07.2009

F5

H4

(CL)

K

  

1014/S/09 K1

Brodnica/07.07.2009

F5

H4

(CL)

H

 

MP-E2

1013/S/09 K4

Brodnica/07.07.2009

F5

H1

(CL)

H

  

1048/S/09 K8

Konin/10.07.2009

F1

H1

(CL)

J

  

1047/S/09 K1

Konin/10.07.2009

F1

H1

(CL)

J

 

MP-E3

KK10

Konin/20.02.2009

F1

H1

(CL)

A

  

848/S/09

Słupca/16.06.2009

F7

No data

(CB)

F

  

865/S/09

Mińsk Mazowieck/18.06.2009

F8

H5

(BB)

G

  

249

Control (PIWet Puławy)

  

(S)

 
  

571/S/09

Brodnica/06.05.2009

F5

H4

(CL)

 
  

KK6

Konin/20.02.2009

F1

H1

(CL)

A

  

866/S/09

Mińsk Mazowieck/18.06.2009

F8

H5

(BB)

G

 

MP-E4

KK11

Konin/20.02.2009

F1

H1

(CL)

A

  

KK12

Konin/20.02.2009

F1

H1

(CL)

A

  

WK-9

Poddębice/28.03.2009

F1

H1

(CL)

C

 

MP-E5

1044/S/09 K2

Konin/10.07.2009

F1

H1

(CL)

J

  

1192/S/09 K8

Poznań/25.07.2009

F13

No data

(CB)

 
 

MP-E6

945/S/09

Żyrardów/26.06.2009

F9

H6

(CB)

 
  

975/S/09

Łomża/30.06.2009

F10

No data

(CB)

 
  

1022/S/09 K9

Turek/08.07.2009

F6

H7

(CB)

I

  

1143/S/09

Konin/21.07.2009

F1

H1

(CL)

 
  

1206/S/09 MEK

Konin/29.07.2009

F1

H1

(CL)

 
  

1231/S/09

No data

No data

No data

  
 

MP-E7

1714/09

Konin/24.09.2009

F16

No data

(CB)

 
  

2149/09

Siedlce/13.11.2009

F18

No data

(CB)

 
 

MP-E8

517/S/09

Piotrków Trybunalski/27.04.2009

F4

No data

(CB)

 
  

838/S/09

Konin/16.06.2009

F1

H1

(CL)

E

  

847/S/09

Słupca/16.06.2009

F7

No data

(CB)

F

  

1085/S/09 MEK

Słupca/14.07.2009

F7

H2

(CB)

 
 

MP-E9

KK9

Konin/20.02.2009

F1

H1

(CL)

A

  

WK-6

Poddębice/28.03.2009

F1

H1

(CL)

C

  

WK-7

Poddębice/28.03.2009

F1

H1

(CL)

C

 

MP-E10

KK3

Konin/20.02.2009

F1

H1

(CL)

A

  

1021/S/09

Turek/08.07.2009

F6

H7

(CB)

I

  

2619/S/10

Słupca/17.07.2010

F7

H7

(CB)

 
  

KK14

Konin/20.02.2009

F1

H1

(CL)

A

 

MP-E11

PK1

Krotoszyn/10.07.2009

F2

H2

(CB)

B

  

1257/S/09 K7

Słupca/03.08.2009

F7

H2

(CB)

 
  

1422/S/09 MEK

Zduńska Wola/21.08.2009

F15

H2

(CB)

 
  

1061/S/09 K5

Słupca/12.07.2009

F7

No data

(CB)

 
  

1545/S/09 MEK

Słupca/08.09.2009

F7

H2

(CB)

M

 

MP-E12

64/S/10

Siedlce/12.01.2010

F3

No data

(CB)

D

  

65/S/10

Siedlce/12.01.2010

F3

No data

(CB)

D

  

1535/S/09

Poznań/05.09.2009

F13

No data

(CB)

 
  

1573/S/09 NWJ

Słupca/11.09.2009

F7

H2

(CB)

N

  

1748

Control (Sanepid)

  

(S)

 
  

D ATCC 13076

Control (Sanepid)

  

(S)

 
 

MP-E13

1446/S/09 K31

Poddębice/25.08.2009

F1

H1

(CL)

L

  

1515/S/09

Mińsk Mazowiecki/03.09.2009

F8

H5

(BB)

 
  

1542/S/09 NWJ

Słupca/08.09.2009

F7

H2

(CB)

M

  

1572/S/09 NWJ

Słupca/11.09.2009

F7

H2

(CB)

N

  

2050/S/09 K4

Kalisz/30.10.2009

F17

No data

(CB)

 
 

MP-E14

833/S/09

Turek/15.06.2009

F6

H7

(CB)

 
  

1465/S/09 MEK

No data

No data

No data

  
  

1171/S/09

Łosice/22.07.2009

F12

No data

(BB)

 
  

1250/S/09

Ostrów Wlkp./03.08.2009

F14

No data

(CB)

 

Moscow

 

289

Control (PIWet Puławy)

  

(S)

 

Virchow

MP-V

GAP K2

Brodnica/03.11.2009

F5

H4

(CL)

O

  

GAP K3

Brodnica/03.11.2009

F5

H4

(CL)

O

  

GAP K4

Brodnica/03.11.2009

F5

H4

(CL)

O

  

394

Control (PIWet Puławy)/2009

  

(S)

 
  

1188/S/09 K10

Konin/24.07.2009

F19

No data

(CB)

 
  

1175/S/09

Żuromin/23.07.2009

F23

No data

(CL)

 
  

PK0

Krotoszyn/10.07.2009

F2

H2

(CB)

B

Colindale

 

180

Control (PIWet Puławy)

  

(S)

 

Berta

 

324

Control (PIWet Puławy)

  

(S)

 

Heidelberg

 

321

Control (PIWet Puławy)

  

(S)

 

Hadar

 

1159/S/09 K2

Łomża/22.07.2009

F10

No data

(CB)

 

Brandenburg

 

584

Control (Sanepid)

  

(S)

 

Derby

 

1282/09

Control (PIWet Puławy)

  

(S)

 

Senftenberg

 

F23/S/09

Żuromin/19.06.2009

 

No data

(CL)

 

Typhimurium

 

1785/S/09

Radziejów/01.10.2009

F29

No data

(CB)

 
  

ATCC 13311

Control (Sanepid)

  

(S)

 
 

MP-T1

1578/S/09

Kalisz/11.09.2009

F17

No data

(CB)

 
  

1751

Control (Sanepid)

  

(S)

 
  

2205/09

Węgrów/9.11.2009

F30

No data

(ES)

 
 

MP-T2

531

Nowy Tomyśl/29.04.2009

F24

No data

(CB)

 
  

1563/S/09

Żyrardów/10.09.2009

F27

No data

(CB)

 
  

1081/S/09 K1

Żuromin/14.07.2009

F23

No data

(CL)

 
 

MP-T3

944/S/09

Poddębice/26.06.2009

F25

H3

(G)

 
  

960/S/09

Konin/29.06.2009

F26

H3

(G)

 
  

1235/S/09

Poddębice/30.07.2009

F25

H3

(G)

 
  

1567/S/09

Kalisz/10.09.2009

F28

No data

(G)

 

Infantis

MP-I1

1021/S/09

Turek/08.07.2009

F6

H7

(CB)

 
  

1593/09

Koło/14.09.2009

F21

H7

(CB)

 
 

MP-I2

ZK4

Konin/01.04.2009

F19

H7

(CB)

Q

  

ZK5

Konin/01.04.2009

F19

H7

(CB)

Q

  

144/S/09

Września/10.02.2009

F20

No data

(CB)

 

Hadar

MP-H

419/S/09

Konin/06.04.2009

F16

H8

(ES)

 
  

817

Control (Sanepid)

  

(S)

 

Mbandaka

 

913/S/09

Ostrów Wlkp./23.06.2009

F22

H4

(CB)

 
 

MP-M

KK1

Mława/11.03.2009

F31

H4

(CB)

P

  

KK2

Mława/11.03.2009

F31

H4

(CB)

P

  

KK3

Mława/11.03.2009

F31

H4

(CB)

P

  

ZK1

Konin/01.04.2009

F19

No data

(CB)

Q

Paratyphi

 

A ATCC 19150

Control (Sanepid)

  

(S)

 

Coexistence column indicates chickens having contact with each other (the same age, the same farm) marked by the same letter

Kind of poultry/sample column indicates: CL commercial layer, CB commercial broiler, BB broiler breeder, G goose, S control strain, ES environmental swabs

Discussion

The gold standard of typing techniques might appear soon the sequencing of the whole genome of a pathogen, which has the highest discriminatory power [2628]. However, for epidemiological purposes, methods with lower discriminatory power are sufficient for many diseases as far as public health is concerned. The investigation of outbreaks, and especially the routine control of Salmonella spread in the poultry industry by monitoring stable or hatchery contamination, requires rapid and inexpensive methods. An interesting alternative to the current set of methods, routinely used for typing of Salmonella, could be ligation-mediated PCR (LM-PCR), which has proven its usefulness in the epidemiological analysis of a number of bacterial species [19, 20, 29]. PCR MP, which controls a number of DNA restriction fragments to be amplified by decreasing the temperature of the denaturation step, was also successfully used [20]. Here, for the first time, we applied PCR MP for the molecular typing of Salmonella strains isolated from both chickens and environmental samples, and we compared the results to those of PFGE with the same collection. The most frequently detected representative of our collection was serovar Enteritidis with 56 strains. It was clearly demonstrated that the discriminatory power of PCR MP (HGDI-0.939) is much higher than that of PFGE (HGDI-0.608). PFGE is an integral subtyping tool used by several national public health networks (e.g., PulseNet, FoodNet, and VetNet) to differentiate outbreak strain clusters [30]. On the other hand, S. Enteritidis is genetically highly monomorphic and PFGE-XbaI is known to display rather poor discriminatory potential for strains of this serovar [31]. PFGE-XbaI protocol lack discriminatory power to show the subtle genotypic differences that distinguish S. Enteritidis strains [32]. Here, the PFGE-E2 cluster with 32 isolates was separated into 11 clusters by PCR MP. Significantly, the number of clusters identified by PCR MP revealed the real epidemiological links among the isolates collected within a single farm (e.g., MP-E1, MP-E4) or those that originated from the same hatchery (e.g., MP-E2, MP-E4). Our findings demonstrated that analysis using PCR MP resulted in a more accurate picture of the phylogeny compared to PFGE. All clusters identified by PCR MP, but not by PFGE, carried strains belonging to the same serovar. Taking the above factors into account, we found PCR MP to be an intriguing one-step PCR-based method with high discriminatory power that may be useful, at least for the connection analysis of S. Enteritidis isolated from poultry. The discriminatory ability of this method is based on the gradual lowering of the denaturation temperature during PCR, which allows for the amplification of less stable DNA fragments (lower G + C content) and precludes the amplification of more stable fragments. As a result, we obtained characteristic DNA profiles that enabled the intraspecies genotyping of Salmonella strains. PCR MP proved a repeatable and specific method for differentiation of Salmonella strains, showing a discriminatory power high enough to identify the real epidemiological links between strains. PCR MP is not the ideal subtyping test as it meets six from the seven defined criteria including cost effectiveness, rapid performance, robust results, typeability, high discrimination and epidemiological concordance [33, 34]. Here the reproducibility was not demonstrated as PCR MP is sensitive to transferability. Based on the present results, PCR MP analysis seems a valuable adjunct to the methods based on sequencing. PCR MP might be an interesting secondary method to verify epidemiological links between strains identified by MLVA and/or MLST. However, to further confirm its usefulness in typing of various Salmonella serovars, its evaluation on a larger number of strains from various geographical regions would be necessary.

Conclusions

PCR MP is highly discriminative, inexpensive, very fast method, which does not need a sophisticated equipment and demonstrates the usefulness in the epidemiological links analysis of a limited collection of Salmonella strains.

Declarations

Acknowledgements

This work was supported partially by grant from the European Regional Development Fund, under Operational Programme Innovative Economy (POIG.01.01.02-10-107/09).

Authors’ Affiliations

(1)
Department of Biochemistry and Cell Biology, University of Rzeszów
(2)
Proteon Pharmaceuticals S.A.
(3)
Molecular Microbiology Department, National Medicines Institute
(4)
Vet- Lab Brudzew
(5)
Institute of Medical Biology, Polish Academy of Science

References

  1. Popoff MY, Bockemühl J, Brenner FW, Gheesling LL. Supplement 2000 (no. 44) to the Kauffmann-White scheme. Res Microbiol. 2001;152:907–9.PubMedView ArticleGoogle Scholar
  2. Sirinavin S, Jayanetra P, Thakkinstian A. Clinical and prognostic categorization of extraintestinal nontyphoidal Salmonella infections in infants and children. Clin Infect Dis. 1999;29:1151–6.PubMedView ArticleGoogle Scholar
  3. Galanis E, Lo Fo Wong DM, Patrick ME, Binsztein N, Cieslik A, Chalermchikit T, et al. World Health Organization Global Salm-Surv. Web-based surveillance and global Salmonella distribution, 2000–2002. Emerg Infect Dis. 2006;12:381–8.PubMed CentralPubMedView ArticleGoogle Scholar
  4. Park SH, Aydin M, Khatiwara A, Dolan MC, Gilmore DF, Bouldin JL, et al. Current and emerging technologies for rapid detection and characterization of Salmonella in poultry and poultry products. Food Microbiol. 2014;38:250–62.PubMedView ArticleGoogle Scholar
  5. Uzzau S, Brown DJ, Wallis T, Rubino S, Leori G, Bernard S, et al. Host adapted serotypes of Salmonella enterica. Epidemiol Infect. 2000;125:229–55.PubMed CentralPubMedView ArticleGoogle Scholar
  6. Wattiau P, Boland C, Bertrand S. Methodologies for Salmonella enterica subsp. enterica subtyping: gold standards and alternatives. Appl Environ Microbiol. 2011;77:7877–85.PubMed CentralPubMedView ArticleGoogle Scholar
  7. Garaizar J, López-Molina N, Laconcha I, Lau Baggesen D, Rementeria A, Vivanco A, et al. Suitability of PCR fingerprinting, infrequent-restriction-site PCR, and pulsed-field gel electrophoresis, combined with computerized gel analysis, in library typing of Salmonella enterica serovar enteritidis. Appl Environ Microbiol. 2000;66:5273–81.PubMed CentralPubMedView ArticleGoogle Scholar
  8. Murase T, Nagato M, Shirota K, Katoh H, Otsuki K. Pulsed-field gel electrophoresis-based subtyping of DNA degradation-sensitive Salmonella enterica subsp. enterica serovar Livingstone and serovar Cerro isolates obtained from a chicken layer farm. Vet Microbiol. 2004;99:139–43.PubMedView ArticleGoogle Scholar
  9. Lienau EK, Strain E, Wang C, Zheng J, Ottesen AR, Keys CE, et al. Identification of a salmonellosis outbreak by means of molecular sequencing. N Engl J Med. 2011;364:981–2.PubMedView ArticleGoogle Scholar
  10. Allard MW, Luo Y, Strain E, Li C, Keys CE, Son I, et al. High resolution clustering of Salmonella enterica serovar Montevideo strains using a next-generation sequencing approach. BMC Genomics. 2012;13:32.PubMed CentralPubMedView ArticleGoogle Scholar
  11. Cao G, Meng J, Strain E, Stones R, Pettengill J, Zhao S, McDermott P, Brown E, Allard M. Phylogenetics and differentiation of Salmonella Newport lineages by whole genome sequencing. PLoS One. 2013;8(2):e55687.Google Scholar
  12. Alcaine SD, Soyer Y, Warnick LD, Su WL, Sukhnanand S, Richards J, et al. Multilocus sequence typing supports the hypothesis that cow- and human-associated Salmonella isolates represent distinct and overlapping populations. Appl Environ Microbiol. 2006;72:7575–85.PubMed CentralPubMedView ArticleGoogle Scholar
  13. Kidgell C, Reichard U, Wain J, Linz B, Torpdahl M, Dougan G, et al. Salmonella typhi, the causative agent of typhoid fever, is approximately 50,000 years old. Infect Genet Evol. 2002;2:39–45.PubMedView ArticleGoogle Scholar
  14. Kotetishvili M, Stine OC, Kreger A, Morris Jr JG, Sulakvelidze A. Multilocus sequence typing for characterization of clinical and environmental Salmonella strains. J Clin Microbiol. 2002;40:1626–35.PubMed CentralPubMedView ArticleGoogle Scholar
  15. Liu F, Barrangou R, Gerner-Smidt P, Ribot EM, Knabel SJ, Dudley EG. Novel virulence gene and clustered regularly interspaced short palindromic repeat (CRISPR) multilocus sequence typing scheme for subtyping of the major serovars of Salmonella enterica subsp. enterica. Appl Environ Microbiol. 2011;77:1946–56.PubMed CentralPubMedView ArticleGoogle Scholar
  16. van Belkum A. Tracing isolates of bacterial species by multilocus variable number of tandem repeat analysis (MLVA). FEMS Immunol Med Microbiol. 2007;49:22–7. Review.PubMedView ArticleGoogle Scholar
  17. Larsson JT, Torpdahl M, MLVA working group, Møller Nielsen E. Proof-of concept study for successful inter-laboratory comparison of MLVA results. Euro Surveill. 2013;18:20566.PubMedGoogle Scholar
  18. Dimovski K, Cao H, Wijburg OL, Strugnell RA, Mantena RK, Whipp M, et al. Analysis of Salmonella enterica serovar Typhimurium variable-number-tandem-repeat data for public health investigation based on measured mutation rates and whole-genome sequence comparisons. J Bacteriol. 2014;196:3036–44.PubMed CentralPubMedView ArticleGoogle Scholar
  19. Masny A, Płucienniczak A. Ligation mediated PCR performed at low denaturation temperatures-PCR melting profiles. Nucleic Acids Res. 2003;31, e114.PubMed CentralPubMedView ArticleGoogle Scholar
  20. Krawczyk B, Samet A, Leibner J, Sledzińska A, Kur J. Evaluation of a PCR melting profile technique for bacterial strain differentiation. J Clin Microbiol. 2006;44:2327–32.PubMed CentralPubMedView ArticleGoogle Scholar
  21. Krawczyk B, Leibner-Ciszak J, Mielech A, Nowak M, Kur J. PCR melting profile (PCR MP)-a new tool for differentiation of Candida albicans strains. BMC Infect Dis. 2009;9:177.PubMed CentralPubMedView ArticleGoogle Scholar
  22. Ciesielska A, Kozłowska M, Gadzalski M, Worek M, Jaworski A, Stączek P. Application of microsatellite-primed PCR (MSP-PCR) and PCR melting profile (PCR-MP) method for intraspecies differentiation of dermatophytes. Pol J Microbiol. 2014;63:283–90.PubMedGoogle Scholar
  23. Seifert H, Dolzani L, Bressan R, van der Reijden T, van Strijen B, Stefanik D, et al. Standardization and interlaboratory reproducibility assessment of pulsed-field gel electrophoresis-generated fingerprints of Acinetobacter baumannii. J Clin Microbiol. 2005;43:4328–35.PubMed CentralPubMedView ArticleGoogle Scholar
  24. Tenover FC, Arbeit RD, Goering RV, Mickelsen PA, Murray BE, Persing DH, et al. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol. 1995;33:2233–9. Review.PubMed CentralPubMedGoogle Scholar
  25. Hunter PR, Gaston MA. Numerical index of the discriminatory ability of typing systems: an application of Simpson’s index of diversity. J Clin Microbiol. 1988;26:2465–6.PubMed CentralPubMedGoogle Scholar
  26. Croucher NJ, Harris SR, Fraser C, Quail MA, Burton J, van der Linden M, et al. Rapid pneumococcal evolution in response to clinical interventions. Science. 2011;331:430–4.PubMed CentralPubMedView ArticleGoogle Scholar
  27. Harris SR, Feil EJ, Holden MT, Quail MA, Nickerson EK, Chantratita N, et al. Evolution of MRSA during hospital transmission and intercontinental spread. Science. 2010;327:469–74.PubMed CentralPubMedView ArticleGoogle Scholar
  28. He M, Sebaihia M, Lawley TD, Stabler RA, Dawson LF, Martin MJ, et al. Evolutionary dynamics of Clostridium difficile over short and long time scales. Proc Natl Acad Sci U S A. 2010;107:7527–32.PubMed CentralPubMedView ArticleGoogle Scholar
  29. Krawczyk B, Leibner-Ciszak J, Stojowska K, Kur J. The new LM-PCR/shifter method for the genotyping of microorganisms based on the use of a class IIS restriction enzyme and ligation mediated PCR. J Microbiol Biotechnol. 2011;21:1336–44.PubMedView ArticleGoogle Scholar
  30. Swaminathan B, Barrett TJ, Hunter SB, Tauxe RV, CDC PulseNet Task Force. PulseNet: the molecular subtyping network for foodborne bacterial disease surveillance, United States. Emerg Infect Dis. 2001;7:382–9.PubMed CentralPubMedView ArticleGoogle Scholar
  31. Thong KL, Ngeow YF, Altwegg M, Navaratnam P, Pang T. Molecular analysis of Salmonella enteritidis by pulsed-field gel electrophoresis and ribotyping. J Clin Microbiol. 1995;33:1070–4.PubMed CentralPubMedGoogle Scholar
  32. Zheng J, Keys CE, Zhao S, Meng J, Brown EW. Enhanced subtyping scheme for Salmonella enteritidis. Emerg Infect Dis. 2007;13:1932–5.PubMed CentralPubMedView ArticleGoogle Scholar
  33. van Belkum A, Tassios PT, Dijkshoorn L, Haeggman S, Cookson B, Fry NK, et al. Guidelines for the validation and application of typing methods for use in bacterial epidemiology. Clin Microbiol Infect. 2007;13 Suppl 3:1–46.PubMedView ArticleGoogle Scholar
  34. Kruczkiewicz P. A comparative genomic framework for in silico design and assessment of molecular typing methods using whole-genome sequence data with application to Listeria monocytogenes. M.Sc. thesis University of Lethbridge, Lethbridge, Canada. 2013.Google Scholar

Copyright

© Zaczek et al. 2015

This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Advertisement