Skip to main content
Download PDF

Development of polymerase chain reaction-lateral flow dipstick assay for detection of Mycoplasma bovis in cattle

BMC Veterinary Research volume 20, Article number: 382 (2024) Cite this article

Abstract

Mycoplasma bovis (M. bovis) is capable of causing a range of diseases in cattle, encompassing calf pneumonia, arthritis, conjunctivitis, meningitis, and mastitis. It is widely recognized as one of the predominant pathogens posing a significant threat to the global cattle industry. Therefore, accurate and sensitive methods are urgently needed to detect M. bovis. This study aims to detect M. bovis by combining colloidal gold with biotin-labeled oligonucleotides to improve detection sensitivity and form a chromogenic detection probe based on signal amplification technology. Here, we developed a sensitive and specific polymerase chain reaction-lateral flow dipstick assay (PCR-LFD) strip for efficient nucleic acid detection of M. bovis. A pair of specific primers with 5’ ends labeled with biotin and digoxigenin probes was designed for PCR experiments. Colloidal gold particles-labeled anti-digoxigenin IgG coated gold-labeled test strip was prepared, streptavidin was used as the detection probe, and nitrocellulose membrane coated goat anti-mouse IgG was used as the control line. Our results showed that the detection limit of the PCR-LFD was 89 fg/µL for the M. bovis DNA. The results from the test strip were highly consistent with those from real-time qPCR. This assay were highly specific for M. bovis, as there were no cross-reactions with other microorganisms tested and the detection sensitivity of the test was also relatively high (97.67%). The novel strips present a promising tool for the cost-effective and sensitive diagnosis of M. bovis.

Peer Review reports

Introduction

Mycoplasma bovis is one of the primary bacterial pathogens contributing to the multifactorial bovine respiratory disease complex, which is associated with pneumonia in cattle [1, 2]. This disease is highly contagious and characterized by coughing, nasal discharge, and acute respiratory distress accompanied by extensive lesions in the lung (pneumonia) [3, 4]. The economic losses caused by M. bovis are estimated to be approximately 150 million euros across Europe as well as over $100 million per year in the USA [5]. M. bovis is recognized as a prominent emerging pathogens in the cattle population of industrialized nations, posing a significant threat to livestock production and causing substantial economic and production losses in both beef and dairy industries [3, 6].

Given the absence of efficacious vaccines against M. bovis [6, 7], cattle farmers worldwide continue to encounter substantial obstacles in managing this formidable disease. Consequently, the implementation of effective husbandry practices, early diagnosis, and efficient antimicrobial therapies are imperative for disease control. Although culturing of M. bovis represents the gold standard method, the presence of vira co-infections and easily cultivable, which are frequently encountered in bovine respiratory diseases (BRD) associated with M. bovis, can potentially complicate diagnostic procedures [5]. The serological diagnosis based on the detection of specific antibodies to M. bovis is a suitable and practical approach for assessing prevalence and conducting epidemiological studies in herds [8], including indirect haemagglutination, growth inhibition, immunohistochemistry, complement binding, agar diffusion, indirect ELISA (I-ELISA) and PCR [9,10,11]. Despite numerous approaches employed for the determination of M. bovis, certain limitations persist in terms of ease of use, sensitivity, specificity, cost-effectiveness, and reliance on specialized equipment or expertise [12]. Recently, nucleic acid amplification combined with lateral flow dipstick (LFD) technique has become apromising molecular technology for low-resource, rapid diagnostics for point-of-care diagnosis in the detection of M. bovis species compared to the aforementioned methods [7, 9].

However, the concentration of specific nucleic acids and proteins in biological samples is typically low, while also being susceptible to interference from numerous substances, thereby potentially resulting in erroneous test outcomes [11, 13, 14]. The utilization of biotin-avidin amplified cascade gold nanoparticle labeling technology for highly sensitive detection represents a pivotal aspect in the realm of analytical chemistry research. The particles in colloidal gold state can form a firm electrostatic bond with the positive charge groups of protein molecules and other biological macromolecules without affecting the biochemical properties of the protein. Additionally, the intense color of colloidal gold provides good contrast for visual detection. Therefore colloidal gold can be used as an ideal immunomarker.

In this study, the signal amplification technology that colloidal gold can be combined with antibody or biotin-labeled oligonucleotides is used to improve the detection sensitivity to form a colorimetric detection probe, which integrates the specificity and sensitivity of PCR. A biotin and digoxigenin probes-based lateral flow strip (used colloidal gold as the labeled materials) were developed and analyzed for their sensitivity and specificity for detection of M. bovis in milk samples from cattle. The established of M. bovis nucleic acid detection test strip method can serve as an alternative method for clinical investigation, epidemic surveillance and disease diagnosis of M. bovis.

Materials and methods

Safety

The care and use of the animals were conducted in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. Procedures involving animals were approved by the Shihezi University Institutional Animal Care and Use Committee.

Reagents and materials

The biosafety trials involved in this study were conducted at Xinjiang Center for Disease Control and Prevention, using the following strains: M. bovis (strain PG45), M. bovis Xinjiang isolates, Mycoplasma ovine pneumonia, Escherichia coli, Pasteurella multocida, Brucella abortus, Bovineviral diarrhea virus, and Mycobacterium bovis. The hydrogen tetrachloroaurate hydrate, trisodium citrate, potassium carbonate, and bovine serum albumin derived from bovine serum were obtained from Sinopharm (Shanghai, China). The mouse anti-digoxigenin immunoglobulin G (IgG) and goat anti-mouse IgG were procured from Luoyang Bai Aotong Experimental Materials Center. The Nitrocellulose (NC) membrane, glass cellulose membrane absorbent pads, sample pads, conjugate pads, and polyvinyl chloride (PVC) sheets were provided by Bioadvantage Co., Ltd.

DNA extraction and generation of standard DNA

The M. bovis and bacterial genomic DNA were extracted with the Bacteria DNA Kit (Takara, Beijing, China), following the manufacturer’s instructions. 2 mL of each sample was centrifuged at 16,000 g for 20 min at 4 °C, phosphate-buffered saline (PBS, pH 7.4) was used to wash the pellet twice after removing the supernatant with impurities and excess liquid. DNA was extracted from the washed pellet and stored at − 80 °C. In order to generate a M. bovis-standard DNA, a PCR product with 448 bp covering the region of interest gene, was amplified from the M. bovis DNA using oppD as primers [15] (oppD-F: CGTTATGCAAGATTAAATACTTACGAC, oppD-R: TGAAACTTTCTCAGCATTAGCC) and cloned into the pMD19-T (Takara, Shanghai, China) for standards. Escherichia coli DH5α cells were transformed with the generating plasmid. Aliquots of the standard DNA were prepared in 10-fold serial dilutions from 1.0 × 107 to 1.0 × 100 copies/mL in nuclease-free water and stored at − 80 °C.

PCR reaction and PCR-LFD assay

The 5’ ends of the upstream and downstream primers of M. bovis were designed to label biotin probes and digoxigenin probes, respectively. The reaction conditions were pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s, annealing at 53 °C for 30 s, and extension at 72 °C for 45 s, a total of 30 cycles; and a final extension at 72 °C for 10 min. The above procedure is performed in Applied Biosystems MiniAmp Plus Thermal cycler (Thermo Fisher Scientific, USA). Using the established PCR reaction system and reaction conditions, the templates of 8 test strains were amplified respectively.

The test strip included a sample pad, a conjugate pad, an absorbent pad, an NC membrane. The conjugate pad contained the colloidal gold particles-labeled anti-digoxigenin IgG, which produced an easily visible red color. Streptavidin and goat anti-mouse IgG were applied as the test (T) and control (C) lines, respectively. Carefully dispense the PCR product onto the nucleic acid test strip and allow it to incubate for approximately 5 min, observing for the appearance of a discernible red band (Fig. 1).

Fig. 1
figure 1

Schematic representation of the PCR-LFD mechanism. (A) Primer labeled with streptavidin and digoxigenin at 5′ end were used for subsequent LFD assay steps. (B) Evaluation of results using PCR-LFD

Full size image

Specificity, sensitivity, repeatability, and concordance rate of the PCR-LFD strip

For the sensitivity test of the strip, M. bovis standard-DNA was diluted with 0.01 mol/L PBS (pH 7.2) to concentrations of 10− 1 (8.9 ng/µL), 10− 2 (890 pg/µL), 10− 3 (89 pg/µL), 10− 4 (8.9 pg/µL), 10− 5 (890 fg/µL), 10− 6 (89 fg/µL), and 10− 7 (8.9 fg/µL). The test should be conducted in accordance with the reaction system, where the samples are applied onto sample pads of the same batch of test strips. Subsequently, the results are observed and a sensitivity test is performed.

The genome DNA of Mycobacterium bovis, Pasteurella multocida, Escherichia coli, Mycoplasma filamentosa, Bovine Viral Diarrhea Virus, Brucella abortus, Mycoplasma Sheepneumoniae, M. bovis PG45 and M. bovis Xinjiang isolates were used as templates for PCR amplification. Simultaneously, agarose gel electrophoresis was performed to detect the amplified products and a specificity test was conducted by applying the product onto the sample pad of the test strip.

For the repeatability analysis, three randomly selected PCR products were diluted with 0.01 mol/L PBS (pH 7.2) to concentrations of 10− 1, 10− 2, 10− 3, 10− 4, 10− 5, 10− 6, and 10− 7.

Comparison of PCR-LFD strips to real-time qPCR

A total of 197 bovine milk samples collected from seven dairy cow farms in Xinjiang Province, China, were screened for M. bovis using the developed strips in parallel to real-time qPCR, which were used according to the manufacturer’s instructions, to compare their specificity, sensitivity, and accuracy.

Results

Evaluation of PCR-LFD nfo primer

The analytical specificity of the PCR methods was evaluated using DNAs of a panel of target and non-target M. bovis (strain PG45), M. bovis Xinjiang isolates, Mycoplasma ovine pneumonia, Escherichia coli, Pasteurella multocida, Brucella abortus, Bovineviral diarrhea virus, and Mycobacterium bovis. All real-time qPCR tests of DNA samples from which M. bovis was expected to be absent showed negative results with Ct values greater than or equal to 37 (Fig. 2A). Furthermore, results from end-point PCR were in agreement with those of real-time qPCRs. The PCR analysis fully confirmed that primer set oppD probe yielded specific amplification efficiency for the detection assay, and produced the expected size of the product of 448 bp (Fig. 2B).

Fig. 2
figure 2

The Primer and PCR-LFD strips specificity verification. (A) Determination of the analytical specificity of oppD by real-time qPCR. (B) Analytical specificity of the PCR assay. (C) Cross‑reactivity of the PCR-LFD strips. Only the M. bovis was amplified and there were no cross reactions with other pathogens tested. Line 1, M. bovis; line 2, M. bovis Xinjiang isolate; line 3, Mycoplasma ovine pneumonia; line 4, Escherichia coli; line 5, Pasteurella multocida; line 6, Brucella abortus; line 7, Bovineviral diarrhea virus; line 8, Mycobacterium bovis

Full size image

Cross-reactivity of the PCR-LFD strips

The cross-reactivity of the test strips was assessed using bovine-susceptible pathogens, including M. bovis (strain PG45), M. bovis Xinjiang isolates, Mycoplasma ovine pneumonia, Escherichia coli, Pasteurella multocida, Brucella abortus, Bovineviral diarrhea virus, and Mycobacterium bovis. While the sample positive for M. bovis yielded positive results on the test strip, all other samples exhibited negative results (Fig. 2C). These findings convincingly demonstrate the suitability of the test strip for detecting M. bovis.

Detection limit of the PCR-LFD strips

To assess the detection limit of the PCR-LFD strip, various concentration gradients were generated by diluting the standard M. bovis DNA with buffer solution. Notably, when the standard M. bovis DNA was diluted to a concentration of 10− 7 (8.9 fg/µL), the PCR-LFD strip yielded a negative result (Fig. 3A). The positive result of the PCR-LFD strip when the standard M. bovis DNA was diluted to 10− 6 indicates that the detection limit of the PCR-LFD strip is 89 fg/µL (Fig. 3A). While the detection limit results of PCR was 890 fg/µL (Fig. 3B), and the detection limit of the PCR-LFD strips was in agreement with real-time qPCRs (Fig. 3C).

Fig. 3
figure 3

Limit of detection of PCR-LFD strips in detecting M. bovis DNA. (A) Results by PCR-LFD (with a detection limit of 89 fg/µL). (B) Results by PCR (with a detection limit of 890 fg/µL). (C) Results by real-time qPCR (with a detection limit of 89 fg/µL)

Full size image

Comparison of PCR-LFD strip results to real-time qPCR

To verify the accuracy of the PCR-LFD and the real-time qPCR, the test strip was used for the detection of M. bovis DNA in 197 clinical samples, including 42 positive samples and 155 negative samples. The results of the comparison of the strip results with those of real-time qPCR were shown in Table 1. The PCR-LFD showed 100% and 97.67% specificity and sensitivity, respectively, compared to real-time qPCR. The lateral flow strips had higher specificity and sensitivity. The results obtained with the lateral flow strips exhibited 99.49% concordance with those of real-time qPCR.

Table 1 Camparision of polymerase chain reaction-lateral flow dipstick assay and real-time qPCR assay on clinical samples
Full size table

Discussion

Mycoplasma mastitis in dairy cattle is commonly caused by M. bovis [16]. Among the primary ways it is transmitted is through ingestion of milk from cows with mastitis, and it is capable of surviving in the milk of asymptomatic and clinically healthy cows [8]. Milk samples from individual cows and bulk tanks have both been used to detect M. bovis in surveillance and eradication efforts [17]. In this study, we present a PCR-LFD strip that can detect the presence of M. bovis DNA in milk in a sensitive and specific manner, which was independent of professional personnel and equipment and can be used for the diagnosis of M. bovis and in molecular diagnosis.

To the best of our knowledge, this is the first instance in which biotin-avidin amplified cascade colloidal gold has been chosen as a labeling material to establish a method for detecting M. bovis DNA in bovine milk, and to describe the results achieved with conjugated proteins and lateral flow test strips using colloidal gold labeling. The biotin-avidin amplified cascade colloidal gold label proved to be effective for the studied lateral flow strips.

Colloidal gold technology is a visual immunochromatographic detection method that is simple to operate, has low production costs, and is widely used in the field of detection and diagnosis. However, this technology has low detection sensitivity. Streptavidin combined with colloidal gold, with the multi-stage amplification effect of the biotin-avidin system, greatly enhances the sensitivity of colloidal gold immunoassay technology. Finally, the red line on a white nitrocellulose background exhibits excellent contrast ratio, as confirmed by visual inspection. Leveraging these characteristics and properties, biotin-avidin amplified cascade gold nanoparticle labeling can be effectively utilized as labels in lateral flow strips.

DNA detection methods for M. bovis are highly dependent on the quality of the targeted Mycoplasma genes used in the test. Thus, to develop reliable molecular methods, it is essential to prepare primers with high specificity. We selected the oppD gene region of M. bovis, which encodes ATP-binding proteins of the ABC-transporter family, was also used as a specific target region in a PCR test and was capable of direct detection of the organism in milk [18]. As a result of DNA amplification, the target band size of M. bovis PG45 and M. bovis Xinjiang isolates was 448 bp in size. In contrast, the empty control and other pathogenic strains failed to detect the amplified band. This shows that the primer has strong specificity, and the reaction system and reaction conditions are suitable.

We further examined the accuracy of the result, including its specificity, sensitivity, and consistency in comparison with the real-time qPCR results. As demonstrated by the results of this study, the detection limit of the PCR-LFD strip is 89 fg/µL. The specificity of the test strip was analyzed by testing several common cattle pathogens, including M. bovis, Pasteurella multocida, Bovineviral diarrhea virus, Brucella abortus, Mycoplasma mycoides, Escherichia coli, Mycoplasma ovipneumoniae and M. bovis Xinjiang isolate. There was no cross-reaction between the PCR-LFD strip and DNA of those pathogens. In order to assess its practicality, the test strip was utilized for the detection of 197 clinical samples. Out of these, the results obtained from the test strip were in agreement with the real-time qPCR results 99.49% of the time.

To the best of our knowledge, this study represents the pioneering utilization of biotin-avidin amplified cascade colloidal gold as a labeling material for establishing a method to detect M. bovis DNA, and we present here the outcomes achieved through conjugated biotin and lateral flow test strips employing colloidal gold labeling. The strip results demonstrate a relative increase in specificity, with no observed cross-reactivity to other bovine pathogens; furthermore, the detection sensitivity has also been enhanced. This technique exhibits suitability for implementation in regions characterized by a high incidence of M. bovis due to its straightforward operation, visually interpretable outcomes, and cost-effectiveness.

Conclusions

The present study describes the development of a novel PCR-LFD strip for rapid and sensitive detection of M. bovis. Its sensitivity and specificity were shown to be comparable to a previously published real-time qPCR. This cost-effective and practical tool holds great promise for diagnosis of M. bovis in clinical samples.

Data availability

Datasets generated during the current study are available from the corresponding author on reasonable request.

References

  1. Pardon B, Callens J, Maris J, Allais L, Van Praet W, Deprez P, Ribbens S. Pathogen-specific risk factors in acute outbreaks of respiratory disease in calves. J Dairy Sci. 2020;103:2556–66.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  2. Oliveira TES, Pelaquim IF, Flores EF, Massi RP, Valdiviezo MJJ, Pretto-Giordano LG, Alfieri AA, Saut JPE, Headley SA. Mycoplasma bovis and viral agents associated with the development of bovine respiratory disease in adult dairy cows. Transbound Emerg Dis. 2020;67(Suppl 2):82–93.

    Article  PubMed  CAS  Google Scholar 

  3. Dudek K, Nicholas RAJ, Szacawa E, Bednarek D. Mycoplasma bovis infections-occurrence. Diagnosis Control Pathogens (Basel Switzerland). 2020;9:640.

    PubMed  CAS  Google Scholar 

  4. Fox LK, Kirk JH, Britten A. Mycoplasma mastitis: a review of transmission and control. J Vet Med B Infect Dis Vet Public Health. 2005;52:153–60.

    Article  PubMed  CAS  Google Scholar 

  5. Nicholas RA, Ayling RD. Mycoplasma bovis: disease, diagnosis, and control. Res Vet Sci. 2003;74:105–12.

    Article  PubMed  CAS  Google Scholar 

  6. Nicholas RA. Bovine mycoplasmosis: silent and deadly. Vet Rec. 2011;168:459–62.

    Article  PubMed  CAS  Google Scholar 

  7. Zhao G, Hou P, Huan Y, He C, Wang H, He H. Development of a recombinase polymerase amplification combined with a lateral flow dipstick assay for rapid detection of the Mycoplasma bovis. BMC Vet Res. 2018;14:412.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  8. Maunsell FP, Woolums AR, Francoz D, Rosenbush RF, Step DL, Wilson DJ, Janzen ED. Mycoplasma bovis infections in cattle. J Vet Intern Med. 2011;25:772–83.

    Article  PubMed  CAS  Google Scholar 

  9. Li R, Wang J, Sun X, Liu L, Wang J, Yuan W. Direct and rapid detection of Mycoplasma bovis in bovine milk samples by recombinase polymerase amplification assays. Front Cell Infect Microbiol. 2021;11:639083.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  10. Nielsen PK, Petersen MB, Nielsen LR, Halasa T, Toft N. Latent class analysis of bulk tank milk PCR and ELISA testing for herd level diagnosis of Mycoplasma bovis. Prev Vet Med. 2015;121:338–42.

    Article  PubMed  Google Scholar 

  11. Parker AM, House JK, Hazelton MS, Bosward KL, Morton JM, Sheehy PA. Bulk tank milk antibody ELISA as a biosecurity tool for detecting dairy herds with past exposure to Mycoplasma bovis. J Dairy Sci. 2017;100:8296–309.

    Article  PubMed  CAS  Google Scholar 

  12. Calcutt MJ, Lysnyansky I, Sachse K, Fox LK, Nicholas RAJ, Ayling RD. Gap analysis of Mycoplasma bovis disease, diagnosis and control: an aid to identify future development requirements. Transbound Emerg Dis. 2018;65(Suppl):91–109.

    Article  PubMed  Google Scholar 

  13. Voltarelli DC, de Alcântara BK, Lunardi M, Alfieri AF, de Arruda Leme R, Alfieri AA. A nested-PCR strategy for molecular diagnosis of mollicutes in uncultured biological samples from cows with vulvovaginitis. Anim Reprod Sci. 2018;188:137–43.

    Article  PubMed  CAS  Google Scholar 

  14. Hotzel H, Sachse K, Pfützner H. Rapid detection of Mycoplasma bovis in milk samples and nasal swabs using the polymerase chain reaction. J Appl Bacteriol. 1996;80:505–10.

    Article  PubMed  CAS  Google Scholar 

  15. Li D, Huang C, Zhang Y, Xie J, Ran Z, Xiong Z, Fan W. Establishment and application of the triplex PCR for detecting M. Bovis, M. mycoides subsp. mycoides small colony type and M. agalactiae. Acta Vet et zootechnica Sinica. 2011;42:306–10. (in Chinese).

    CAS  Google Scholar 

  16. Gioia G, Werner B, Nydam DV, Moroni P. Validation of a Mycoplasma molecular diagnostic test and distribution of Mycoplasma species in bovine milk among New York State dairy farms. J Dairy Sci. 2016;99:4668–77.

    Article  PubMed  CAS  Google Scholar 

  17. Pinho L, Thompson G, Machado M, Carvalheira J. Management practices associated with the bulk tank milk prevalence of Mycoplasma spp. indairy herds in Northwestern Portugal. Prev Vet Med. 2013;108:21–7.

    Article  PubMed  CAS  Google Scholar 

  18. Sachse K, Salam HS, Diller R, Schubert E, Hoffmann B, Hotzel H. Use of a novel real-time PCR technique to monitor and quantitate Mycoplasma bovis infection in cattle herds with mastitis and respiratory disease. Vet J. 2010;186:299–303.

    Article  PubMed  CAS  Google Scholar 

Download references

Acknowledgements

We thank our laboratory members who helped us to improve the research and the manuscript, with their skillful technical assistance, invaluable comments, and suggestions.

Funding

This work was supported by grants from the Transformation and Application Demonstration of Rapid Screening Technology Achievements for Important Animal Diseases in Intensive Breeding (grant no. 21322912D), Young Innovative Talent Program (grant no. CXPY202323) and Tianchi talent Project.

Author information

Author notes

  1. Shengnan Song, Jia Guo and Yang Zhao Equally contributed to this work as a first author.

Authors and Affiliations

  1. State International Joint Research Center for Animal Health Breeding, College of Animal Science and Technology, Shihezi University, Shihezi, China

    Shengnan Song, Jia Guo, Yang Zhao, Yong Wang, Zhen Wang & Chuangfu Chen

  2. College of Life Science, Shihezi University, Shihezi, China

    Feng Shi

  3. State Key Laboratory for Sheep Genetic Improvement and Healthy Production, Xinjiang Academy of Agricultural and Reclamation Science, Shihezi, 832003, China

    Qian Zhang

Authors
  1. Shengnan Song
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Jia Guo
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Yang Zhao
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Feng Shi
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Yong Wang
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Qian Zhang
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Zhen Wang
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Chuangfu Chen
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

C.F., Z.W., and Q.Z. conceived and designed the experiments. S.N. and J.G. participated in the experiments and wrote the manuscript. Y.Z., F.S., Y.W., and Q.Z. performed the experiments. S.N. and J.G. collect the experimental materials. All authors read and approved the final manuscript.

Corresponding authors

Correspondence to Qian Zhang, Zhen Wang or Chuangfu Chen.

Ethics declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Song, S., Guo, J., Zhao, Y. et al. Development of polymerase chain reaction-lateral flow dipstick assay for detection of Mycoplasma bovis in cattle. BMC Vet Res 20, 382 (2024). https://doi.org/10.1186/s12917-024-04238-x

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12917-024-04238-x

Keywords

BMC Veterinary Research

ISSN: 1746-6148

Contact us