- Case Report
- Open access
- Published:
An unexpected case of a dog from Poland co-infected with Dirofilaria repens and Dirofilaria Immitis
BMC Veterinary Research volume 20, Article number: 66 (2024)
Abstract
Background
Dirofilariasis is a vector-borne disease caused by parasitic nematodes of the genus Dirofilaria spp., considered an emerging concern in both veterinary and human medicine. Climate changes and human activities, such as pet travel, contribute to the spread of diseases to new non-endemic regions. Poland is dominated by subcutaneous dirofilariasis caused by D. repens infections. Cardiopulmonary dirofilariasis, also known as a heartworm disease is much more rare with only single autochthonous cases reported so far. Also, imported infections are observed sporadically in dogs traveling to endemic countries. In this study, we report the first case of a dog in Poland, never having traveled abroad, co-infected with Dirofilaria repens and Dirofilaria immitis.
Case presentation
A 14-year-old mixed breed, an intact male dog with fever, lightly pale mucosal membranes, moderate abdominal pain, and a mild cough was presented in a veterinary clinic in Warsaw, Poland. The examination of the blood sample collected for complete morphology and biochemistry revealed the presence of live microfilariae. Presence of the DNA of both microfilariae species was detected using Real-Time PCR with species-specific primers.
Conclusions
Since the remaining diagnostic methods like Knott’s test, antigen test or echocardiography did not reveal the presence of D. immitis, we discussed the impact of microfilariae periodicity and low worm burden infections on the limited efficiency of these techniques. We strongly recommend using a mixed diagnostic approach for the most sensitive and specific diagnosis since the ideal diagnostic method does not exist, and several factors may contribute to misdiagnosis. Furthermore, we considered factors that contribute to the uncontrolled spread of dirofilariasis such as climate changes, introduction of new species of mosquitoes competent for the transmission of the disease, and wildlife animals as an important reservoir of this parasitosis. Given that Poland shares borders with countries classified as endemic and pre-endemic for D. immitis, such as Slovakia and Ukraine, it is reasonable to anticipate a rise in autochthonous heartworm infections and shifts in the epidemiological pattern of dirofilariasis in the coming years.
Background
Dirofilariasis is a vector-borne disease caused by parasites from the genus Dirofilaria spp. Dirofilaria repens is a causative agent of subcutaneous dirofilariasis whereas D. immitis causes cardiopulmonary dirofilariasis, also known as heartworm disease [1]. While the primary hosts are carnivores, both parasites exhibit zoonotic potential and can infect humans. The disease is spreading worldwide, gradually expanding into new non-endemic areas year after year. Direct causes of spreading the disease are climate changes, which lead to the introduction of new species of mosquitoes competent for disease transmission. Additionally, increased movement of pets, especially those lacking sufficient protection, contributes to the spread [2].
Both Dirofilaria species are widespread in Europe, but their distribution in specific regions differs. D. repens infections are prevalent across Europe and endemic in many countries of both Southern and Central Europe. Moreover, the risk of new endemic regions emerges in North Europe and Baltic countries, where infections have occurred more frequently in recent years [3, 4]. Heartworm infections have predominantly been observed in Southern Europe, particularly in the hyper-endemic Mediterranean region. In the rest of Europe, especially in the central part, infections have been reported only occasionally. However, according to Morchón et al. [5], the epidemiological situation is constantly changing. Over the last 10 years, the prevalence of the disease not only increased in previously endemic areas but also spread across new non-endemic regions. Single imported cases or occurrences of infected mosquitoes were reported even in Northern Europe countries like Norway [6] and Denmark [2].
Near Poland, Slovakia is a region that can be considered endemic. Over the years, D. immitis infections have become more and more frequent in the regions that up to this time were dominated by D. repens [7, 8]. Currently, heartworm disease, both in mono-infection and co-infection with D. repens, represents 45% of all dirofilarial infections in Slovakia. Between 2017 and 2021 mixed infections of D. repens and D. immitis represented 22.5% of all diagnosed cases of canine dirofilariasis in endemic regions of Slovakia [8]. Moreover, in 2022 an autochthonous case of human heartworm infection was confirmed in this area [9]. Interestingly, in the bordering Czech Republic, only imported cases have been identified so far [10]. A significant number of D. immitis infections have been detected in Germany in recent years, all of which were associated with imported or traveling dogs. In addition, in some regions of the country D. immitis DNA was identified in a pool of mosquitoes competent for transmission of the heartworm disease [11]. Based on these reports, Germany may be considered a pre-endemic area [5].
Beyond Poland’s eastern border, in Lithuania, a single imported case of canine cardiopulmonary dirofilariasis was identified [12] and in Belarus, D. immitis DNA was detected in a pool of competent mosquitoes [13]. In the case of Ukraine, data on prevalence in dogs are limited, but 1465 cases of human infections caused by D. repens were reported in the years 1997–2012 [14] and in the other study among 102 cases, a few were identified as D. immitis [15]. Based on these findings Ukraine is considered endemic for both species [16].
Poland is dominated by subcutaneous dirofilariasis. The first case of D. repens infection in Poland was reported in humans in 2007 [17, 18], but the patient traveled to Greece a few years earlier so invasion might have been imported. The first autochthonous infection in humans was reported in 2010 [19], with subsequent cases described in the following years [19,20,21,22,23]. The first case of canine dirofilariasis was described in 2009 [24, 25], and since then the prevalence of infected dogs has been increasing steadily. In 2014, the overall prevalence of infected dogs across all 16 provinces reached almost 16% [26], whereas in 2016 only in the Mazovia district the percentage of infected dogs was 38.3% [27]. In a recent study conducted in 2017–2019, the prevalence in Poland was 12% [3].
The first case of a dog infected with D. immitis was described in 2012 in Gdynia [28] based on the SNAP test (IDEXX) detecting adult female antigens and has been suspected to be autochthonous. Despite this, only one additional autochthonous case was described in Silesia in 2014 [29]. Importantly, physicians sporadically observe imported infections in dogs that have traveled to endemic countries (data unpublished, based on personal communication). In light of climate changes and Poland’s proximity to countries where D. immitis is endemic (Slovakia, Ukraine) and pre-endemic (Germany), we have every reason to expect an increase in autochthonous infections shortly.
Here we report a case of a dog from Poland co-infected with Dirofilaria repens and D. immitis, that has never traveled abroad. To our best knowledge, this is the first confirmed case of autochthonous D. immitis infection in a dog from Poland using molecular methods.
Case presentation
Case report
In autumn 2022, a 14-year-old mixed breed, an intact male dog was brought to a veterinary clinic in Warsaw, Poland, for an evaluation due to general lameness. Clinical signs included: fever (39.5 ℃), lightly pale mucosal membranes, moderate abdominal pain, and mild cough. No lymphadenopathy of the peripheral lymph nodes and no deviations from the standard image in the ultrasound examination of the abdominal cavity were observed. A blood sample was collected to complete morphology and biochemistry tests, and then anti-inflammatory and antiemetic drugs were implemented. The results are showed in the Table 1.
Because of lowered PLT the CaniV-4 rapid test was performed (One-step Canine Heartworm Antigen and Ehrlichia canis; Borrelia burgdorferi; Anaplasma phagocytophilum Antibody Test, Vetexpert). The test was positive on Anaplasma antibodies and antibiotic treatment with doxycycline at a dose of 10 mg/per kilo/day, for 7 days was implemented. After a week of treatment, the dog’s health status did not show any noticeable improvement. A follow-up blood sample was obtained for a control morphology blood test and blood smear. While no Anaplasma was observed in the smear, live microfilariae were detected in the native blood sample. Molecular analyzes confirmed the presence of microfilariae from both D. repens and D. immitis, with a higher quantity of D. repens indicated Ct (cycle threshold) values obtained through Real-Time PCR. The dog had no lumps in the skin and the control echocardiography showed no visible adult forms of Dirofilaria spp. in the heart. The control radiography of the thorax in dorsoventral and lateral projections showed no deviations. Based on information from the owner, the dog has never traveled abroad but it lived in the vicinity of dogs traveling outside Poland’s borders.
The dog was treated with a combination of imidacloprid 250 mg and moxidectin 62.5 mg in spot-on drops (Advocate, Bayer) according to the following treatment schedule: four doses of the drug administrated at four-week intervals. Additionally, doxycycline (10 mg/kg/day) was continued for a total of one month due to Anaplasma sp. and Wolbachia. After 2 months the follow-up blood test showed no microfilariae in the bloodstream and all the blood and biochemistry parameters were in the correct ranges. During the following months, the dog was under constant medical care.
Knott’s test
One ml of blood was mixed with 9 ml of 4% formalin and centrifuged for 10 min at 500 × g. The supernatant was discarded and the pellet was stained with 1% methylene blue. One drop was deposited on the glass slide and examined under the light microscope at 10× and 40× magnification. The Knott’s test revealed the presence of microfilariae, displaying features typical of D. repens, including a blunt-end head with a short cephalic space, a distinct pair of nuclei, and a hooked tail. The average length and width of the presented microfilariae were measured at 364,3 μm and 6,2 μm, respectively (Fig. 1). These distinctive characteristics collectively confirm the identification of the microfilariae as belonging to D. repens [30, 31]. No microfilariae of D. immitis were detected. However, given the low intensity of microfilaremia (200 mf/ml of whole blood) and the observation of only single microfilariae on the slide, it is possible that they were omitted during the examination.There was no opportunity to repeat the examination of microfilariae as the next blood samples were collected already at a check-up visit one month after the treatment has been implemented.
Molecular detection
300 µl of blood was used for the isolation of genomic DNA using Blood Mini Kit (AA Biotechnology) according to the manufacturer’s protocol. The isolated gDNA was used as a template in Real-Time PCR reaction with primers targeted at the D. repens 16s rRNA gene described in our previous study [32] and newly designed species-specific primers for D. immitis (ForDI 5’ ACTGATGTTATTATTCTATGTGTTTGGG 3’; RevDI 5’ TTCAAAGAATCCCACTCTAAAAACCTC 3’). The novel primers targeted the small fragment of mtDNA located between tRNA and ND6 genes (starts at 3960 bp and ends at position 4109 bp), were designed based on the reference mitochondrial genomes of D. immitis (NC_005305.1) and D. repens (NC_029975.1) so that 3’ mismatches would discriminate and would not amplify D. repens DNA fragments.
Reactions were performed in triplicate according to the two-step fast cycling protocol (PowerUp™ SYBR™ Green Master Mix, Applied Biosystems™), followed by the melt curve step in a QuantStudio 6 Real-Time PCR system (Applied Biosystems) according to the manufacturer’s protocol. After the UDG (Uracil-DNA Glycosylase) activation step (2 min at 50 °C) followed by initial denaturation (2 min, 95 °C), 40 cycles of amplification were performed (3 s at 95 °C, 30 s at 60 °C). The reaction volume was 10 µl and consisted of 5 µl of 2× Master mix, 3 µl of the isolated DNA, 1 µl of each primer in a final concentration of 0.6 µM. Data were collected during the annealing/extension step.
The specificity of the amplified products was confirmed based on the melt curve peaks compared to the reference samples and Sanger’s sequencing. Reference samples were as follows: gDNA isolated from adult D. repens (N = 1) and D. immitis worm (N = 1); gDNA isolated from the blood of dogs infected with D. repens (N = 10) and D. immitis (N = 10); gDNA isolated from the blood of dogs co-infected with both species (N = 5). All samples related to D. immitis were derived from Slovakia.
The specificity of the designed primers was confirmed in all reference samples. Melt curve analysis revealed peaks specific for D. immitis and D. repens with Tm ∼ 71 °C (Fig. 2) and ∼ 72 °C, respectively. The novel primers specific for D. immitis amplified only D. immitis gDNA (microfilariae or adult). No amplification was observed in reactions with D. repens gDNA (microfilariae or adult).
Both genes of interest were amplified with the gDNA isolated from the blood of the described dog which indicates co-infection. Tm of melt curves were consistent with reference samples and sequencing of the amplified DNA fragments showed almost 100% similarity to s16 rDNA and “DI fragment” for D. repens and D. immitis, respectively. The sequencing of the amplicons was outsourced to Genomed S.A., where each sample was bidirectionally sequenced using the same gene-specific primers employed in our real-time PCR analysis.
Interestingly, the product specific for D. immitis presented a much higher Ct value (Ct ∼ 35), than the one specific for D. repens (Ct ∼ 29). That indicates the predominance of D. repens in the bloodstream and seems to correspond to the Knott’s test result, where D. immitis microfilariae have not been even detected. We assume that the number of D. immitis microfilariae was too low to be noticeable in Knott’s test. There may be a few explanations for this phenomenon related to the biology of the parasite.
Discussion and conclusions
Mixed infections of both species are not uncommon and have already been reported in several countries [10, 33,34,35] with a relatively high prevalence. For example, in Romania’s 2015 report, mixed infections represented 23.91% of all positive samples [36]. Interestingly, the predominance of microfilariae of one of the species over the other has also been frequently observed, e.g. 7780 mf/ml and 427 mf/ml of D. immitis and D. repens, respectively [34, 37]. A similar scenario has been observed in naturally co-infected dogs in Slovakia (personal communication, prof. Martina Miterpáková). Genchi et al. [38] observed this phenomenon in experimentally infected dogs and suggested that the interaction of both species may disrupt the progress of each other and pointed out that it may impact the further distribution of dirofilariasis in different regions. Periodic fluctuations in microfilariae levels, influenced by factors like host behavior and environmental conditions, can impact the effectiveness of standard morphological/molecular examinations. Studies suggest a link between microfilaremia dynamics and host habits, as well as vector activity in specific regions [37]. Seasonal variation in microfilaremia is evident, peaking during summer [39,40,41]. Although limited, research on mixed infections in dogs reveals a shared circadian rhythm between parasites, with peripheral microfilaremia highest at 1 am and lowest between 5 and 8 am. Intriguingly some cases showed zero microfilariae of one species between 9 and 11 am [37], supporting the assumption that during low-count phases, microfilariae concentrate in lung vessels [42].
These findings appear consistent with our situation, as the blood sample for differentiating the infection collected at 10.30 am corresponds to a period of low peripheral microfilaremia (200 mf/ml), possibly contributing to the absence of D. immitis in the Knott’s test. However, we recognize that sampling at a single time point is a limitation and may not definitively conclude the absence of D. immitis due to time of day. Regrettably, additional sampling at varied time points was not feasible in this case.
In addition, a negative result of the antigen test and no sign of adult worms may indicate low worm burden infection [43], which also complies with AHS (American Heartworm Society) [44] and ESDA (European Society of Dirofilariosis and Angiostrongylosis) [45] directives. While echocardiography is crucial for assessing the severity of the infection, it may also be misleading, particularly in lightly infected dogs, where worms could be beyond the field of view. Sporadically, D. immitis worms have also been reported in various atypical locations [46, 47]. As described, the patient did not show any specific heartworm symptoms, only occasional coughing and general lameness were observed. The infection should be considered “mild” and “Class 1 with low risk of thromboembolic complications”, according to AHS and ESDA directives, respectively [44, 45].
Here, we report the first case of a naturally co-infected dog with both D. repens and D. immitis in Poland, marking the third documented case of heartworm infection in the country overall. While the country is not considered pre-endemic, we believe heartworm disease may be underestimated, leading to potential undiagnosed or misdiagnosed cases.
Climate changes introduce vectors competent for transmission and extend the exposure time to infection, allowing more Dirofilaria generations in a season. Mosquito larval development, influenced by temperature, shows the fastest progress at 28–30 °C, taking 8–9 days for D. immitis and 9–13 for D. repens, with a threshold of 14 °C below which Dirofilaria will not evolve [48]. This information led to the creation of a seasonal heartworm (HW) transmission model, enabling the prediction of Dirofilaria occurrences [49,50,51]. Recently, suitable conditions were occasionally observed in Northern European countries such as Sweden, Norway, Finland, and Denmark [2]. Human activities are also crucial for the transmission of the disease to non-endemic regions. Traveling with insufficiently protected and/or not properly examined pets contribute to the appearance of new outbreaks of the disease, that within a short period may lead to the endemization in new areas. According to Fuehrer et al. [2], more than 30% of dogs in Poland are kept outside overnight, placing them at an increased risk of mosquito bites.
Although the awareness of dirofilariasis increased in recent years and epidemiological data is being updated locally, still there are some research areas where the data is limited. One of them is molecular xenomonitoring which recently was improved in many European countries and several protocols have been described [52,53,54]. In Poland, only two studies have been conducted in this field, [55, 56] and provided estimates of the infection rate (EIR) at 1.57% for D. repens in the Central part of Poland. Neither D. immitis, nor D. repens DNA was detected in vectors collected from Southern West part of Poland. Although examining hundreds or even thousands of mosquitoes for a single infected individual might seem economically questionable, xenomonitoring offers valuable insights into transmission risk and the actual epidemiological status.
Unfortunately, the ongoing neglect of infections in free-living carnivores remains a significant contributing factor to the uncontrolled spread of dirofilariasis. Foxes, jackals, wolves, and raccoon dogs in Europe have been identified with infections from both Dirofilaria species. Recent findings in beech martens [57] and European badgers [58] suggest a potentially broader natural host range, prompting discussions on their roles as reservoir hosts. In a recent study, Alsarraf et al. [59] reported that the overall prevalence in Poland reached 3.13%, which corresponds with similar studies conducted in other European countries [60,61,62]. Interestingly, in neighboring Slovakia, D. repens infections were detected in 54.97–57.4% of examined foxes [63, 64]. Moreover, only in the Tatry region (the natural borderline between Poland and Slovakia), the prevalence in foxes reached 24.6% [65]. In light of possible patent infections and the absence of preventive or therapeutic interventions in fox populations, these animals could facilitate access to microfilariae for new mosquito genera, particularly given their nocturnal habits and proximity to human habitats. Foxes’ nomadic tendencies and capacity for long-distance travel further amplify the risk of disease spread. Nonetheless, the infrequent occurrence of microfilaremia and the inconsistency in available data mean that the true impact of foxes as reservoirs is still subject to debate.
As Poland is surrounded by at least two endemic (Slovakia, Ukraine) and one pre-endemic (Germany) country, we suppose that subsequent cases of both imported and autochthonous infections will be reported more frequently in the following years. Interestingly, in a recent study, Alsarraf et al. demonstrated that genetic diversity among populations of dogs infected with both D. repens and D. immitis appears to be linked to their geographical origin [16, 66]. The ongoing cultivation of this field of study could significantly contribute to understanding the origin of infections and monitoring the potential migration between populations.
In summary, following the OneHealth approach, it is essential to rigorously monitor the epidemiological situation not just in dogs but also in humans, wildlife animals, and insects. Our case supports the thesis that a mixed diagnostic approach based on morphological, molecular, and serological techniques provides the most sensitive and specific diagnosis.
Data availability
Derived data supporting the findings of this study are available from the corresponding author MP on request.
References
Genchi C, Kramer LH. The prevalence of Dirofilaria immitis and D. repens in the Old World. Vol. 280, Veterinary Parasitology. 2020.
Fuehrer HP, Morelli S, Unterköfler MS, Bajer A, Bakran-Lebl K, Dwużnik-Szarek D et al. Dirofilaria spp. and Angiostrongylus vasorum: Current risk of spreading in central and northern Europe [Internet]. Vol. 10, Pathogens. Multidisciplinary Digital Publishing Institute; 2021 [cited 2022 Jan 3]. p. 1268. Available from: https://www.mdpi.com/2076-0817/10/10/1268/htm.
Alsarraf M, Levytska V, Mierzejewska EJ, Poliukhovych V, Rodo A, Alsarraf M et al. Emerging risk of Dirofilaria spp. infection in Northeastern Europe: high prevalence of Dirofilaria repens in sled dog kennels from the Baltic countries. Sci Rep. 2021;11(1).
Jensen AL, Krogh AKH, Lundsgaard JFH, Willesen JL, Lyngby JGH, Schrøder AS et al. Dirofilaria repens in a dog imported to Denmark: A potential for emerging zoonotic disease. Vet Parasitol Reg Stud reports [Internet]. 2023 Jun 1 [cited 2023 May 25];41. Available from: https://pubmed.ncbi.nlm.nih.gov/37208081/.
Morchón R, Montoya-Alonso JA, Rodríguez-Escolar I, Carretón E. What Has Happened to Heartworm Disease in Europe in the Last 10 Years? [Internet]. Vol. 11, Pathogens. Multidisciplinary Digital Publishing Institute (MDPI); 2022 [cited 2023 May 18]. Available from: /pmc/articles/PMC9503846/.
Vatne LI. Heartworm infection caused by Dirofilaria immitis in a dog imported to Norway Dirofilariasis Aetiology and epidemiology. Nor Veterinaertidsskrift [Internet]. 2014 [cited 2023 May 18];126(7):60–7. Available from: http://www.ejcap.org.
Miterpáková M, Valentová D, Čabanová V, Berešíková Ľ. Heartworm on the rise—new insights into Dirofilaria immitis epidemiology. Parasitol Res [Internet]. 2018 Jul 1 [cited 2023 May 18];117(7):2347–50. Available from: https://link.springer.com/article/https://doi.org/10.1007/s00436-018-5912-9.
Miterpáková M, Valentová D. Dirofilaria immitis a Dirofilaria repens v teritoriálnom boji. Veterinarstvi. 2023;73(3):128–32.
Miterpáková M, Antolová D, Rampalová J, Undesser M, Krajcovic T, Víchová B. Dirofilaria immitis Pulmonary Dirofilariasis, Slovakia. Emerg Infect Dis [Internet]. 2022 Feb 1 [cited 2023 May 18];28(2):482–5. Available from: /pmc/articles/PMC8798700/.
Miterpáková M, Hurníková Z, Valentová D, Borková L. Different epidemiological pattern of canine dirofilariosis in two neighboring countries in Central Europe—the Czech Republic and Slovakia. Parasitol Res [Internet]. 2021 Feb 1 [cited 2023 May 23];120(2):547–52. Available from: https://link.springer.com/article/https://doi.org/10.1007/s00436-020-06995-8.
Kronefeld M, Kampen H, Sassnau R, Werner D. Molecular detection of Dirofilaria immitis, Dirofilaria repens and Setaria tundra in mosquitoes from Germany. Parasit Vectors [Internet]. 2014 Jan 16 [cited 2023 May 18];7(1):30. Available from: /pmc/articles/PMC3898823/.
Sabūnas V, Radzijevskaja J, Sakalauskas P, Paulauskas A. First Report of Heartworm (Dirofilaria Immitis) Infection in an Imported Dog in Lithuania. Helminthologia [Internet]. 2019 [cited 2023 May 18];56(1):57. Available from: /pmc/articles/PMC6662024/.
Șuleșco T, Volkova T, Yashkova S, Tomazatos A, von Thien H, Lühken R et al. Detection of Dirofilaria repens and Dirofilaria immitis DNA in mosquitoes from Belarus. Parasitol Res [Internet]. 2016 Sep 1 [cited 2023 May 18];115(9):3535–41. Available from: https://link.springer.com/article/10.1007/s00436-016-5118-y.
Sałamatin RV, Pavlikovska TM, Sagach OS, Nikolayenko SM, Kornyushin VV, Kharchenko VO et al. Human dirofilariasis due to Dirofilaria repens in Ukraine, an emergent zoonosis: Epidemiological report of 1465 cases. Acta Parasitol [Internet]. 2013 Dec 13 [cited 2023 May 18];58(4):592–8. Available from: https://link.springer.com/article/10.2478/s11686-013-0187-x.
Rossi A, Peix Á, Pavlikovskaya T, Sagach O, Nikolaenko S, Chizh N, et al. Genetic diversity of Dirofilaria spp. isolated from subcutaneous and ocular lesions of human patients in Ukraine. Acta Trop. 2015;142:1–4.
Alsarraf M, Baneth G, Bogucka-Kocka A, Ciuca L, Dwużnik-Szarek D, Fuehrer HP, et al. Haplotypes of Dirofilaria repens from Poland and selected countries of Central, North-Eastern Europe and the Middle East: an evaluation on the relation between the genetic diversity and the geographic distribution of the fast-spreading parasite. Vet Parasitol. 2023;315:109882.
Cielecka D, Szymanska K, Sałamatin R, Tomaszewska A. Case report of human infection with Dirofilaria repens (Leidy, 1856) (Nematoda: Filarioidea: Onchocercidae) in Warsaw. Wiadomości Parazytol [Internet]. 2007 [cited 2023 May 18];53:165. Available from: https://yadda.icm.edu.pl/yadda/element/bwmeta1.element.agro-article-af7f102c11bd-445f-87e6-48ab62849bfe/c/165.PDF.
Żarnowska-Prymek H, Cielecka D, Salamatin R. Dirofilarioza—Dirofilaria repens, po raz pierwszy opisana u polskich pacjentów. Przegl Epidemiol. 2008;62:547–51.
Cielecka D, Zarnowska-Prymek H, Masny A, Salamatin R, Wesołowska M, Gołab E. Human dirofilariosis in Poland: the first cases of autochthonous infections with Dirofilaria repens. Ann Agric Environ Med. 2012;19(3):445–50.
Rymgayłło-Jankowska B, Ziaja-Sołtys M, Flis B, Bogucka-Kocka A, Żarnowski T. Subcutaneous Dirofilariosis of the Eyelid Brought to Poland from the Endemic Territory of Ukraine. Pathogens [Internet]. 2023 Feb 1 [cited 2023 May 18];12(2). Available from: /pmc/articles/PMC9966818/.
Kłudkowska M, Pielok L, Frackowiak K, Masny A, Gołab E, Paul M. Dirofilaria repens infection as a cause of intensive peripheral microfilariemia in a Polish patient: process description and cases review. Acta Parasitol. 2018;63(3):657–63.
Kołodziej P, Szostakowska B, Jarosz B, Pojasek S, Romak M, Kocki J et al. The First Case of Elbow Bursitis Caused by Dirofilaria repens in Humans. Open Forum Infect Dis [Internet]. 2019 Apr 1 [cited 2023 May 18];6(4). Available from: /pmc/articles/PMC6483126/.
Mazur-Melewska K, Figlerowicz M, Masny A, Cielecka D, Mania A, Trejster E, et al. The first autochthonous infection with Dirofilaria repens in a child in Poland. J Pediatr Infect Dis. 2013;8(4):187–90.
Demiaszkiewicz A, Polańczyk G. Pierwszy przypadek inwazji Dirofilaria repens Railliet et Henry, 1911 u psa w Polsce. Mag Weter [Internet]. 2010 [cited 2023 May 18];19:254–6. Available from: https://scholar.google.com/scholar?hl=pl&as_sdt=0%2C5&q=Pierwszy+przypadek+inwazji+Dirofilaria+repens+Railliet+et+Henry%2 C+1911+u+psa+w+Polsce&btnG=.
Demiaszkiewicz AW, Polańczyk G, Pyziel AM, Kuligowska I, Lachowicz J. The first foci of dirofilariosis of dogs evoked by Dirofilaria repens Railliet et Henry, 1911 in central Poland. Wiadomości Parazytol. 2009;55(4):367–70.
Demiaszkiewicz AW, Polańczyk G, Osińska B, Pyziel AM, Kuligowska I, Lachowicz J et al. The prevalence and distribution of Dirofilaria repens in dogs in the Mazovian Province of Central-Eastern Poland. Ann Agric Environ Med [Internet]. 2014 Nov 26 [cited 2023 May 18];21(4):701–4. Available from: https://www.aaem.pl/The-prevalence-and-distribution-of-Dirofilaria-repens-in-dogs-in-the-The-prevalence,72182,0,2.html.
Bajer A, Rodo A, Mierzejewska EJ, Tołkacz K, Welc-Faleciak R. The prevalence of Dirofilaria repens in cats, healthy dogs and dogs with concurrent babesiosis in an expansion zone in central Europe. BMC Vet Res [Internet]. 2016 Sep 5 [cited 2023 May 18];12(1). Available from: https://pubmed.ncbi.nlm.nih.gov/27595920/.
Świątalska A, Demiaszkiewicz A. Pierwszy w Polsce rodzimy przypadek inwazji nicieni Dirofilaria immitis u psa. Życie Weter [Internet]. 2012 [cited 2023 May 18];87:685–6. Available from: https://www.esccap.pl/datastore/download/PierwszywPolscerodzimyprzypadekinwazjiD.immitisupsa.pdf.
Noszczyk-Nowak A, Janus I, Bielewska J, Nowak M, Soltysiak Z. Pierwszy w Polsce potwierdzony pośmiertnie przypadek infestacji Dirofilaria immitis u psa. Dowód na Rozprzestrzenianie się Choroby. Weter w Prakt. 2014;11(06).
Liotta JL, Sandhu GK, Rishniw M, Bowman DD. Differentiation of the Microfilariae of Dirofilaria immitis and Dirofilaria repens in Stained Blood Films. https://doi.org/101645/12-101 [Internet]. 2013 Jun 1 [cited 2024 Jan 8];99(3):421–5. Available from: https://bioone.org/journals/journal-of-parasitology/volume-99/issue-3/12-10.1/Differentiation-of-the-Microfilariae-of-Dirofilaria-immitis-andhttps://doi.org/10.1645/12-10.1.full.
Capelli G, Genchi C, Baneth G, Bourdeau P, Brianti E, Cardoso L et al. Recent advances on Dirofilaria repens in dogs and humans in Europe. Vol. 11, Parasites and Vectors. 2018.
Pękacz M, Basałaj K, Kalinowska A, Klockiewicz M, Stopka D, Bąska P et al. Selection of new diagnostic markers for Dirofilaria repens infections with the use of phage display technology. Sci Rep [Internet]. 2022 Dec 1 [cited 2023 May 18];12(1). Available from: https://pubmed.ncbi.nlm.nih.gov/35145147/.
Farkas R, Mag V, Gyurkovszky M, Takács N, Vörös K, Solymosi N. The current situation of canine dirofilariosis in Hungary. Parasitol Res [Internet]. 2020 Jan 1 [cited 2023 May 18];119(1):129–35. Available from: https://pubmed.ncbi.nlm.nih.gov/31754854/.
Mircean M, Ionică AM, Mircean V, Györke A, Codea AR, Tăbăran FA et al. Clinical and pathological effects of Dirofilaria repens and Dirofilaria immitis in a dog with a natural co-infection. Parasitol Int [Internet]. 2017 Jun 1 [cited 2021 Aug 25];66(3):331–4. Available from: https://pubmed.ncbi.nlm.nih.gov/28232044/.
Sonnberger K, Duscher GG, Fuehrer HP, Leschnik M. Current trends in canine dirofilariosis in Austria-do we face a pre-endemic status? Parasitol Res [Internet]. 2020 Mar 1 [cited 2023 May 18];119(3):1001–9. Available from: https://pubmed.ncbi.nlm.nih.gov/32056024/.
Ionică AM, Matei IA, Mircean V, Dumitrache MO, D’Amico G, Győrke A et al. Current surveys on the prevalence and distribution of Dirofilaria spp. and Acanthocheilonema reconditum infections in dogs in Romania. Parasitol Res [Internet]. 2015 Feb 21 [cited 2023 May 18];114(3):975–82. Available from: https://link.springer.com/article/https://doi.org/10.1007/s00436-014-4263-4.
Ionică AM, Matei IA, D’Amico G, Bel LV, Dumitrache MO, Modrý D et al. Dirofilaria immitis and D. repens show circadian co-periodicity in naturally co-infected dogs. Parasit Vectors [Internet]. 2017 Feb 28 [cited 2023 May 18];10(1). Available from: https://pubmed.ncbi.nlm.nih.gov/28245837/.
Genchi C, Basano FS, Bandi C, di Sacco B, Venco L, Vezzoni A, et al. Factors influencing the spread of heartworms in Italy. Interaction between Dirofilaria Immitis and Dirofilaria repens. American Heartworm Society. American Heartworm Society; 1995. pp. 65–71.
Kume S. Experimental Observations on Seasonal Periodicity of Microfilariae. In: Heartworm Symposium ’74. VM Publishing, Inc.; 1975. p. 26–31.
Sawyer TK. Seasonal Fluctuations of Microfilariae in Two Dogs Naturally Infected with Dirofilaria immitis. In: Heartworm Symposium ’74. VM Publishing, Inc.; 1975. p. 23–5.
Cancrini G, Coluzzi M, Balbo T, Gallo MG. Seasonal variations in microfilarema and effects of ambient temperature in dogs parasitized by Dirofilaria repens. Parassitologia [Internet]. 1975 Jan 1 [cited 2023 May 19];17(1–3):75–82. Available from: https://europepmc.org/article/med/1233403.
Hawking F. Microfilaria infestation as an instance of periodic phenomena seen in host-parasite relationships. Ann N Y Acad Sci [Internet]. 1962 Oct 1 [cited 2023 May 19];98(4):940–53. Available from: https://onlinelibrary.wiley.com/doi/full/https://doi.org/10.1111/j.1749-6632.1962.tb30610.x.
Atkins CE. Comparison of results of three commercial heartworm antigen test kits in dogs with low heartworm burdens. J Am Vet Med Assoc [Internet]. 2003 May 1 [cited 2021 Aug 25];222(9):1221–3. Available from: https://pubmed.ncbi.nlm.nih.gov/12725308/.
AHS. Current canine guidelines for the prevention, diagnosis, and management of heartworm (Dirofilaria immitis) infection in dogs. 2020.
ESDA. Guidelines for clinical management of canine heartworm disease. 2021.
Penezić A, Kuručki M, Bogdanović N, Pantelić I, Bugarski-Stanojević V, Ćirović D. Heartworm Disease in Jackals: Unusual Location of Dirofilaria immitis. Acta Parasitol [Internet]. 2022 Sep 1 [cited 2023 May 19];67(3):1412–5. Available from: https://link.springer.com/article/https://doi.org/10.1007/s11686-022-00567-9.
Sevimli FK, Kozan E, Bülbül A, Birdane FM, Köse M, Sevimli A. Dirofilaria immitis infection in dogs: Unusually located and unusual findings. Parasitol Res [Internet]. 2007 Nov 22 [cited 2023 May 19];101(6):1487–94. Available from: https://link.springer.com/article/10.1007/s00436-007-0665-x.
Genchi C, Rinaldi L, Mortarino M, Genchi M, Cringoli G. Climate and Dirofilaria infection in Europe. Vet Parasitol. 2009;163(4):286–92.
Slocombe JOD, Surgeoner GA, Srivastava B et al. Proceedings of the Heartworm Symposium ’89: Charleston, South Carolina, March 17–19, 1989. In: Otto GF, Jackson RF, Knight DH, Campbell WC, Courtney CH, Dillon R, editors. Determination of the heartworm transmission period and its used in diagnosis and control. American Heartworm Society; 1989. p. 19–26.
Knight DH, Lok JB. Proceedings of Heartworm Symposium’92, American Heartworm Society, Baravia, IL. In: M.D. Soll, D.H. Knight, editors. Seasonal timing of heartworm chemoprophylaxis in the United States. 1995. p. 37–42.
Fortin JF, Slocombe JOD. Temperature requirements for the development of Dirofilaria immitis in Aedes triseriatus and Ae. vexans. Mosq News [Internet]. 1981 [cited 2023 May 19];December(4):625–33. Available from: https://www.biodiversitylibrary.org/part/131550.
Latrofa MS, Montarsi F, Ciocchetta S, Annoscia G, Dantas-Torres F, Ravagnan S et al. Molecular xenomonitoring of Dirofilaria immitis and Dirofilaria repens in mosquitoes from north-eastern Italy by real-time PCR coupled with melting curve analysis. Parasit Vectors [Internet]. 2012 [cited 2023 May 19];5(1). Available from: https://pubmed.ncbi.nlm.nih.gov/22520170/.
Bocková E, Rudolf I, Kočišová A, Betášová L, Venclíková K, Mendel J et al. Dirofilaria repens microfilariae in Aedes vexans mosquitoes in Slovakia. Parasitol Res [Internet]. 2013 Oct [cited 2023 May 20];112(10):3465–70. Available from: https://pubmed.ncbi.nlm.nih.gov/23846240/.
Silbermayr K, Eigner B, Joachim A, Duscher GG, Seidel B, Allerberger F et al. Autochthonous Dirofilaria repens in Austria. Parasit Vectors [Internet]. 2014 May 14 [cited 2023 May 20];7(1). Available from: https://pubmed.ncbi.nlm.nih.gov/24885284/.
Masny A, Sałamatin R, Rozej-Bielicka W, Golab E. Is molecular xenomonitoring of mosquitoes for Dirofilaria repens suitable for dirofilariosis surveillance in endemic regions? Parasitol Res [Internet]. 2016 Feb 1 [cited 2023 May 20];115(2):511–25. Available from: https://link.springer.com/article/https://doi.org/10.1007/s00436-015-4767-6.
Rydzanicz K, Golab E, Rozej-Bielicka W, Masny A. Screening of mosquitoes for filarioid helminths in urban areas in south western Poland-common patterns in European Setaria tundra xenomonitoring studies. Parasitol Res [Internet]. 2019 Jan 23 [cited 2023 May 20];118(1):127–38. Available from: https://pubmed.ncbi.nlm.nih.gov/30535561/.
Miterpáková M, Hurníková Z, Zaleśny G, Chovancová B. Molecular evidence for the presence of Dirofilaria repens in Beech marten (Martes foina) from Slovakia. Vet Parasitol. 2013;196(3–4):544–6.
Ionică AM, Deak G, Boncea R, Gherman CM, Mihalca AD. The European Badger as a New Host for Dirofilaria immitis and an Update on the Distribution of the Heartworm in Wild Carnivores from Romania. Pathog (Basel, Switzerland) [Internet]. 2022 Apr 1 [cited 2023 May 20];11(4). Available from: https://pubmed.ncbi.nlm.nih.gov/35456095/.
Alsarraf M, Dwużnik-Szarek D, Hildebrand J, Mierzejewska EJ, Kloch A, Kot K et al. Occurrence of Dirofilaria repens in wild carnivores in Poland. Parasitol Res [Internet]. 2023 May 1 [cited 2023 May 20];122(5):1229. Available from: /pmc/articles/PMC10097766/.
Penezić A, Selaković S, Pavlović I, Ćirović D. First findings and prevalence of adult heartworms (Dirofilaria immitis) in wild carnivores from Serbia. Parasitol Res [Internet]. 2014 Sep 1 [cited 2023 May 20];113(9):3281–5. Available from: https://link.springer.com/article/https://doi.org/10.1007/s00436-014-3991-9.
Ionicǎ AM, Matei IA, D’Amico G, Ababii J, Daskalaki AA, Sándor AD et al. Filarioid infections in wild carnivores: a multispecies survey in Romania. Parasit Vectors [Internet]. 2017 Jul 13 [cited 2023 May 20];10(1). Available from: https://pubmed.ncbi.nlm.nih.gov/28705255/.
Tolnai Z, Széll Z, Sproch Á, Szeredi L, Sréter T. Dirofilaria immitis: an emerging parasite in dogs, red foxes and golden jackals in Hungary. Vet Parasitol. 2014;203(3–4):339–42.
Hurníková Z, Miterpáková M, Zaleśny G. Epidemiological coherency of vulpine dirofilariosis in environmental conditions of Slovakia. Helminthol. 2015;52(1):11–6.
Lecová L, Letková V. The prevalence of Dirofilaria spp. in domesticated and wild carnivores in Slovakia. Folia Vet [Internet]. 2009 [cited 2023 May 20];53(3):160–1. Available from: https://www.uvlf.sk/document/folia-veterinaria-volume-53-issue-3.pdf.
Hurníková Z, Miterpáková M, Čabanová V, Chovancová G. Free-living carnivores as an important reservoir of zoonotic parasites in the Tatra Mountains region, Slovakia. Ann Parasitol. 2016.
Alsarraf M, Carretón E, Ciuca L, Diakou A, Dwużnik-Szarek D, Fuehrer HP et al. Diversity and geographic distribution of haplotypes of Dirofilaria immitis across European endemic countries. Parasit Vectors [Internet]. 2023 Dec 1 [cited 2024 Jan 8];16(1). Available from: /pmc/articles/PMC10498598/.
Acknowledgements
Not applicable.
Funding
This research was funded by National Centre for Research and Development, grant number 0106/L-9/2017.
Author information
Authors and Affiliations
Contributions
MP: Conceptualization, Methodology, Validation, Formal analysis, Investigation, Writing - Original Draft, Writing - Review & Editing. KB: Writing - Review & Editing, Formal analysis. MM: Resources, Writing - Review & Editing. ZR: Resources, Writing - Original Draft. DS: Resources. DG: Resources. AZD: Writing - Review & Editing, Supervision, Project administration, Funding acquisition.
Corresponding author
Ethics declarations
Ethics approval and consent to participate
The owners of the dog were informed about the results of Dirofilaria testing. Written informed consent was not obtained from the owners because no interventions except routine care were performed. All analyzes were performed on the leftovers of blood samples collected during routine checkups or the diagnosis process by veterinarians in veterinary clinic in accordance with relevant guidelines and regulations.
Consent for publication
Not applicable.
Competing interests
The authors declare no competing interests.
Additional information
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
About this article
Cite this article
Pękacz, M., Basałaj, K., Miterpáková, M. et al. An unexpected case of a dog from Poland co-infected with Dirofilaria repens and Dirofilaria Immitis. BMC Vet Res 20, 66 (2024). https://doi.org/10.1186/s12917-024-03921-3
Received:
Accepted:
Published:
DOI: https://doi.org/10.1186/s12917-024-03921-3