Skip to content

Advertisement

Open Access

Correction to: Antibiotic resistance pattern and virulence genes content in avian pathogenic Escherichia coli (APEC) from broiler chickens in Chitwan, Nepal

  • Manita Subedi1,
  • Rebanta Kumar Bhattarai2,
  • Bhuminand Devkota1,
  • Sarita Phuyal1 and
  • Himal Luitel1Email author
BMC Veterinary Research201814:166

https://doi.org/10.1186/s12917-018-1453-9

Received: 5 April 2018

Accepted: 13 April 2018

Published: 22 May 2018

The original article was published in BMC Veterinary Research 2018 14:113

Correction

The original article [1] contains errors in author panels and their contributions, errors in both the Methodology and the Results sections, and errors with respect to funding sources. The affected sections of the manuscript and their respective regions of corrected text can be viewed ahead:

Authorship

The correct authors of the original article [1] can be viewed in the header of this manuscript.

Methods

Sample collections, bacterial isolation and identification

Fifty liver samples were collected from 50 colibacillosis suspected broiler chickens which were attended from May 2016 to January 2017 for routine diagnosis at National Avian Disease Investigation Laboratory (NADIL) and Veterinary Teaching Hospital, Agriculture and Forestry University, Rampur, Nepal.

Detection of virulence genes

Isolated E. coli strains were investigated for the presence of eleven virulence genes (iutA, iss, papC, iucD, tsh, irp-2, ompT, hlyF, iron, cva/cvi, and astA) which are associated with colibacillosis. For the detection of virulence genes, genomic DNA was extracted from pure cultures of E. coli grown overnight in the MacConkey agar at 37 °C by using the DNeasy Blood and Tissue Kit (Qiagen, catalogue no. 69506). The quality of genomic DNA was checked by gel electrophoresis and measuring absorbance at A260/A280 and A260/A230 ratios using the Quawell UV spectrophotometer (Q3000, USA). The conventional PCR was used to amplify the virulence genes. The primers used for amplification were those described previously (Table 1) [17, 18]. The PCR was performed in 25 μL volume containing 12.5 μL Hot start Taq 2X master mix (BioLab Inc., New England), 1 μL each primer (1 μM concentration), 2 μL (20 ng/μL optimized by dilution) DNA template, and 8.5 μL nuclease free water. The PCR amplifications were conducted in T100™ Thermal Cycler (Bio-Rad, USA) and the cycling conditions were identical for all the samples as follows: 94 °C for 4 min; 35 cycles of 30 s at 94 °C, 1 min at 60 °C, and 2 min at 68 °C; and 72 °C for 7 min. The amplicons were analyzed by agarose gel electrophoresis with 1.5% agarose gel (Sigma-Aldrich, A4718) prepared in 1× TBE buffer (Thermo Fisher Scientific, B52). All the PCR products were stained with ethidium bromide. After electrophoresis, the bands were visualized and photographed under UV light. The amplified product was considered to contain virulence gene if it produced band of the expected size.
Table 1

Primer sets for detection of target virulence genes from avian pathogenic Escherichia coli (APEC) isolates

Genes

Primer Sequence (5′–3′)

Amplicon size (bp)

iutA

F: GGCTGGACATCATGGGAACTGG

R: CGTCGGGAACGGGTAGAATCG

302

iss

F: CAGCAACCCGAACCACTTGATG

R: AGCATTGCCAGAGCGGCAGAA

309

papC

F: TGATATCACGCAGTCAGTAGC

R: CCGGCCATATTCACATAA

501

iucD

F: ACAAAAAGTTCTATCGCTTCC

R: CCTGATCCAGATGATGCTC

714

tsh

F: ACTATTCTCTGCAGGAAGTC

R: CTTCCGATGTTCTGAACGT

824

irp-2

F: AAGGATTCGCTGTTACCGGAC

R: AACTCCTGATACAGGTGGC

413

ompT

F: TCATCCCGGAAGCCTCCCTCACTACTAT

R: TAGCGTTTGCTGCACTGGCTTCTGATAC

496

hlyF

F: GGCCACAGTCGTTTAGGGTGCTTACC

R: GGCGGTTTAGGCATTCCGATACTCAG

450

iroN

F: AATCCGGCAAAGAGACGAACCGCCT

R:GTTCGGGCAACCCCTGCTTTGACTTT

533

cva/cvi

F: TGGTAGAATGTGCCAGAGCAAG

R: GAGCTGTTTGTAGCGAAGCC

1181

astA

F: TGCCATCAACACAGTATATCC

R: TCAGGTCGCGAGTGACGGC

116

Results

A total of 50 E. coli strains were isolated from 50 liver swab samples of colibacillosis suspected broiler chickens. The antibiogram profile of E. coli isolates showed highest resistance to ampicillin (98%) and least resistance to amikacin (16%) (Fig. 1). Out of 50 E. coli isolates, 47 (94%) isolates were resistant to three or more antibiotics. The MAR index analysis showed 94% of E. coli isolates had MAR index value of > 0.2 and 6% had MAR index value of ≤0.2. The proportions of isolates with the MAR index values of 0.3, 0.4, 0.5, and 0.6 were 12% 20%, 22%, and 20%, respectively. There was no significant association of prevalence of antibiotic resistant strains with the type of E. coli strains (P > 0.05).

Based on the genetic criteria for the pathogenicity, isolates containing at least five virulence genes were considered as the APEC strains and isolates containing less than five virulence genes were considered as the avian non-pathogenic Escherichia coli (non-APEC) strains. Out of 50 E. coli isolates, 45 (90%) isolates were found to be APEC strains and 5 (10%) isolates were found to be non-APEC strains (Table 2). Among 50 E. coli isolates, 7 isolates contained all the eleven virulence genes, 14 isolates contained ten virulence genes, 15 isolates contained nine virulence genes, 5 isolates contained eight virulence genes, 2 isolates contained seven virulence genes, 2 isolates contained five virulence genes, 4 isolates contained 4 virulence genes, and 1 isolates contained 3 virulence genes.

Declarations

Funding

This work was supported financially by Directorate of Research and Extension (DOREX), Agriculture and Forestry University, Rampur, Chitwan, Nepal and National Agricultural Research Development Fund (NARDEF), Nepal.

Authors’ Contributions

HL, BD and RKB conceived the concept, design, and supervised this study. MS and SP performed experimental work. MS, RKB and HL analyzed data and prepared the final draft of the manuscript. All authors read and approved the final manuscript.

References

Reference [24] in the original article mistakenly omits some author details and as such, the correct presentation of this reference can be seen in reference [2] of this Correction article.

Notes

Declarations

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Center for Biotechnology, Agriculture and Forestry University, Rampur, Nepal
(2)
Department of Veterinary Microbiology and Parasitology, Agriculture and Forestry University, Rampur, Nepal

References

  1. Subedi M, et al. Antibiotic resistance pattern and virulence genes content in avian pathogenic Escherichia coli (APEC) from broiler chickens in Chitwan, Nepal. BMC Vet Res. 2018;14:113.View ArticlePubMedPubMed CentralGoogle Scholar
  2. Parul S, Bist B, Sharma B, Jain U. Virulence associated factors and antibiotic sensitivity pattern of Escherichiacoli isolated from cattle and soil. Vet World 2014;7(5):369–72.Google Scholar

Copyright

© The Author(s). 2018

Advertisement