Skip to main content

Table 1 Primers used for RT-qPCR

From: The immune mechanism of Mycoplasma hyopneumoniae 168 vaccine strain through dendritic cells

Gene Sequence (5’ to 3’)
IL-10 forwardIL-10 forward TCTGAGAACAGCTGCATCCAC
IL-10 reverse CGCCCATCTGGTCCTTCGTT
IL-12 forward TCAGAAGGCCAAACAAACCCT
IL-12 reverse GGCAACTCTCATTCGTGGCTA
INF-γ forward CGCAAAGCCATCAGTGAACTCA
INF-γ reverse TCTGGCCTTGGAACATAGTCT
GAPDH forward TCATCATCTCTGCCCCTTCT
GAPDH reverse GTCATGAGTCCCTCCACGAT