Skip to main content

Genital tract lesions in sexually mature Göttingen minipigs during the initial stages of experimental vaginal infection with Chlamydia trachomatis serovar D



Chlamydia is one of the most common sexually transmitted diseases in humans worldwide, causing chronic lesions in the reproductive tract. Due to its often asymptomatic course, there is limited knowledge about the initial changes in the genital tract following infection. This study employs a novel sexually mature minipig model to investigate the initial histopathological changes following vaginal infection with Chlamydia trachomatis serovar D.


A vaginal inoculation resulted in an infection primarily affecting the lower genital tract. The histopathological changes were characterized by a subepithelial inflammation consisting of neutrophils and mononuclear cells, followed by an increase in the number of plasma cells within the sub-epithelial stroma of the vagina. Detection of Chlamydia was associated with expression of cyclooxygenase-2 and interleukin-8 by superficial epithelial cells. The infection was self-limiting, with a duration of 7 days.


Neutrophils, plasma cells and IL-8 have been linked with Chlamydia genital infection of unknown duration in human patients. In this study, we observe a similar pattern of local immune response/inflammation following experimental inoculation suggesting this porcine model shows promise as a model for translational chlamydia research.


Chlamydia is one of the most common sexually transmitted infections in humans, with more than 100 million new cases per year [1]. Genital infection with Chlamydia trachomatis (C. trachomatis) in women can lead to long term sequelae such as infertility, chronic pelvic pain and in worst case life threatening complications, e.g. ectopic pregnancy [2]. Our understanding of the pathogenesis of acute C. trachomatis infection in the genital tract of women is limited because the majority are asymptomatic [3]. Murine models are often used for translational studies of Chlamydia infections and in particular using the mouse pathogen, Chlamydia muridarum [4]. Models based on non-human primates (NHPs) are in general more comparative to humans than rodent models. Different studies, reviewed by Bell et al., have shown that a genital infection with C. trachomatis in NHPs elicits histological changes in the mucosa of the vagina, cervix and the oviducts, resembling the inflammatory response in humans [5]. However, pigs are increasingly being used as models for the study of human diseases as they are less expensive and more accessible laboratory animals than NHPs. Moreover, compared with rodents, porcine physiology and the porcine immune system are more comparable to humans [68]. Also, with respect to reproductive biology porcine models are preferred, as pigs are polyoestrous with a cycle length of 21 days; compared to a 5 day murine cycle [9]. Furthermore, the porcine vagina is suitable for both in vitro and in vivo studies due to the similarities between its structure and function with that in women [10, 11]. The use of pigs for experimental Chlamydia studies has been reported in a single study of a primary genital C. trachomatis infection, and in three vaccine studies [1215]. In these studies, prepubertal gilts were used. No systematic evaluations of histological changes have been reported for early stages of infection in pigs or NHPs.

In humans, genital Chlamydia infection most often occurs in sexually mature adolescents [16]. The sexually mature genital tract differs from the immature tract, in size, epithelial thickness, vascularization, immune cell infiltration and hormonal fluctuation [1720]. Given that hormones influence the susceptibility of endometrial cells to chlamydial infection [21, 22], sexually mature pigs should constitute a good model for the human disease.

In this study, we investigated the histopathological and immunological changes in the initial stages of infection with C. trachomatis serovar D (SvD) in sexually mature Göttingen minipigs, acting as a model of human genital chlamydia. The characterization included immunohistochemical staining of cyclooxygenase-2 (cox-2), a key enzyme for prostaglandin synthesis in the early inflammatory response in both pigs and humans, and interleukin-8 (IL-8), which has a similar function as proinflammatory cytokine and neutrophil chemoattractant in both pigs and humans, and is additionally known to be upregulated following C. trachomatis infection [2326].


Chlamydia trachomatis

C. trachomatis SvD (Trachoma type D strain UW-3/Cx, ATCC® VR-885™) was propagated in HeLa cells as previously described [27]. Briefly, the HeLa cells were cultured in six well plates and infected with 1.5 C. trachomatis SvD inclusion forming units (IFU) per HeLa cell. The infection was followed by centrifugation at 750 g for 1 h, and thereafter incubated at 35 °C for 2 h, after which the media was enriched with 0.5 % glucose and 1 μg/ml cyclohexamide. The plates were incubated at 37 °C for 48 h, and thereafter harvested and purified as described by Olsen et al. [27].

The concentration of infectious bacteria was determined by culturing bacterial suspensions on McCoy-cells [28]. The plates were incubated at 37 °C for 22 h. Visualization of inclusions was made by incubating the cells with polyclonal rabbit antibodies against chlamydial Major Outer Membrane Protein and chlamydial Heat Shock Protein-60 [29], and thereafter stained with 4 μg/ml Alexa Fluor 488 labelled goat-anti rabbit antibody (Life Technologies) and kept in the dark at 4 °C until microscopy was carried out.

The cell plates were evaluated using a fluorescent microscope (Olympus IX71). Inclusion bodies were enumerated by counting positively stained inclusions in at least 20 fields in each well using the 40x objective on microscope. Results were calculated as average of duplicate samples.

Experimental animals

Ten 7 to 8 month old sexually mature female Göttingen minipigs were raised in a barrier facility at Ellegaard Göttingen Minipigs A/S, Dalmose, Denmark, declared free of Chlamydia infection and a number of other infections as documented by a FELASA-approved health monitoring report. The experimental study was performed in the Laboratory Animal Isolation Unit at the University of Copenhagen. The gilts were housed in groups of 3–4 with wooden shavings as bedding material, fed twice daily with standard minipig diet and had ad libitum access to water. In addition, genital tracts were also obtained as histologic control tissue from six age-matched gilts, raised at the same facility as the experimental animals.

Study design

The study design is illustrated in Fig. 1. The gilts were treated orally for 18 days (20 mg/day) with a progestagen (Regumate Equine®, MSD Animal Health, Ballerup, Denmark) to synchronize their oestrus cycles and then evaluated daily for signs of oestrus. When characteristic signs of oestrus were evident, such as vulvar erythema, oedema, and increased physical activity (4–5 days after discontinuation of treatment), the pigs were anaesthetized with Zoletil-50® mixture [30] intramuscularly. Chlamydial inoculation was performed under sterile conditions using an insemination catheter (Osiris, E-vet, Denmark) placed in the most cranial portion of the vagina (external uterine orifice). The bacterial suspension deposited consisted of 1.8 × 109 IFU in 5 ml of 250 mmol/l sucrose, 10 mmol/l NaH2PO4, and 5 mmol/l L-glutamic acid (SPG) buffer. The caudal part of each pig was slightly elevated for 20 min post-inoculation to minimize reflux of the inoculum.

Fig. 1

Experimental design. Ten sexually mature minipigs were intravaginally inoculated with C. trachomatis at oestrus. The pigs were euthanised and sampled on day 3, 5 and 7 post inoculation (PI). As controls for the histological stainings, genital organs from six age-matched, healthy, non-treated gilts were also included (not shown in the figure)

Vaginal swabs were taken immediately prior to inoculation and at euthanasia. Moreover, vaginal swabs were collected on day 3 and 5 post inoculation (PI). The pigs were sedated during the sampling and sterile procedures were applied. The vaginal swabs were immediately placed in 1 ml SPG buffer and kept on ice until further processing. Glass beads were added to the sample tubes, and the samples were whirlmixed for 1 min. Fresh samples of 100 μl were used for culturing. The remainder of each sample was aliquoted in tubes and stored at -80 °C.

The pigs were clinically monitored daily. Any changes in behaviour, food intake, or in defecation/urination patterns were noted. Moreover, the vulva was inspected for erythema, oedema, and discharge. Rectal temperature was measured daily from the day before inoculation until euthanasia. Fever was defined as a rectal temperature >39.5 °C. On the day of inoculation, the rectal temperature was taken 6–9 h PI. The pigs were euthanized on days 3 (n = 4), 5 (n = 3), and 7 (n = 3) PI by deep anaesthesia followed by exsanguination.


The pigs were examined for grossly visible lesions [31] and the entire reproductive tract was isolated and mucosal swabs from vagina, cervix, uterine corpus, uterine horns, and oviducts were taken and transferred into 1 ml SPG. Mucosal swabs were handled similarly to the vaginal swabs, were aliquoted and stored at -80 °C. Samples of vagina, cervix, uterine horns, and oviducts were fixed in 10 % neutral buffered formalin for 48 h prior to transfer into 70 % ethanol until further processing.

Tissue processing and histological examination

Tissue samples were trimmed, processed routinely, and embedded in paraffin. Sections of 3–4 μm were cut, mounted on SuperFrost®/Plus glass (Hounisen, Denmark), deparaffinised and rehydrated by standard methods. For histopathological evaluation, the slides were stained with haematoxylin and eosin, and examined without prior knowledge of experimental treatment. The phase of the oestrous cycle was determined as “peri-oestrus” (ranging from pro-oestrus to early di-oestrus) or “dioestrus”, based on histological changes in the uterine horns; Peri-oestrus if the epithelium was pseudostratified, subbasilary bands of neutrophils were found, and apoptotic cells were detected in the endometrial and/or glandular epithelium, and dioestrus if no apoptotic cells and subbasilar neutrophils were found, the epithelium was columnar and the glandular layer hypertrophic [32, 33].

Immunohistochemistry (IHC)

Selected sections of tissues of infected animals and control tissues were cut, deparaffinised and rehydrated by standard methods. To detect chlamydial antigen, all sampled areas of the vagina and cervix were examined; sections from the upper genital tract were also examined by IHC when inflammation was observed histologically and/or if the corresponding sample was positive by q-PCR. All sections of vagina and cervix were stained for IgM, IgA, IgG, cox-2, and IL-8. Antibody dilutions, antigen retrieval, quenching of endogenous peroxidase, blocking steps, and application of antibodies and enhancers were performed as detailed in Table 1 and according to the manufacturer’s protocol. The slides were counterstained with haematoxylin and mounted with an aqueous medium. TBS was used as washing buffer between the steps. Negative control-sections were included by replacing the primary antibody with a nonsense isotype-matched antibody from the same species. Positive control sections known to contain chlamydial antigen were included.

Table 1 Details of immunohistochemical protocols

IgM, IgA and IgG-positively stained cells in the vaginal and cervical mucosa were counted in a zone 100 μm from the basal layer; at least 20 fields were counted with a 20x objective. The average number of antibody expressing cells/mm2 was calculated. Similar staining and counting was performed in sections from the corresponding anatomical locations in the uninfected controls. Cox-2 and IL-8 expressing epithelial cells were counted in the whole section, and the length of the epithelium measured using A Cell software (Olympus). Cellular expression was measured as numbers of positive cells/mm epithelium. Similar staining and counting was performed in the control specimens.

Vaginal chlamydial load by culturing

Culturing of vaginal swabs was made by a titrated inoculation of McCoy cells [28], with some minor adaptions, equivalent to the previously described procedure for determining bacterial concentrations.

DNA extraction and q-PCR detection of C. trachomatis

DNA extraction from the swabs was performed with Chelex®100 (Bio-Rad, Life Science, Denmark). Swab material (100 μl) was mixed with 300 μl of a 20 % Chelex solution in TE buffer (T9285, Sigma Aldrich), vortexed for 60 s and incubated at 96 °C for 10 min. The sample was then centrifuged for 10 min at 17,500 g at 4 °C, diluted 1:10 and hereafter triplicates of 5 μl of the supernatant were used for q-PCR.

Real-time q-PCR detection of C. trachomatis in the vaginal swab samples was performed by detection of the 16S rRNA gene. An internal control (IC) was systematically run to detect possible inhibition of the PCR. The following primers and probes were used: C. trachomatis 16 s-F GGATCTTCGGACCTTTCGGT; C. trachomatis 16 s-R AATCTCTCAATCCGCCTAGACA; C. trachomatis 16 s-probe FAM-AAGGGAGAGTCTATGTGATAT – MGBNFQ (Applied Biosystems); IC-F 5′ACCGCTCAGGCATTTGCT-3′; IC-R 5′CCGGGACGTATCATGCT3′ (TAG Copenhagen A/S, Copenhagen, Denmark), IC-probe NED-TCCTTCGTGATATCGGACGTTGGCTG- MGBNFQ (Applied Biosystems). The assay was performed with a final reaction volume of 20 μl with: Perfecta q-PCR SuperMix (UNG, low ROX, 95066-02 K (2000 rx) Quantum Biosciences), 300 nM of each primer, 75 nM of each of the probes, IC-DNA and DEPC treated water was added up to a total volume of 20 ul. The samples were run on a StepOne™ Real-time PCR instrument (Applied Biosystems®) programmed to run 2 min at 95 °C and 40 cycles of denaturation at 95 °C for 15 s and annealing/ extension at 60 °C for 1 min. The Ct cutoff was determined to be 38 hence Ct values greater than 38 were considered negative.

Chlamydia-specific antibody response in serum

An indirect enzyme-linked immunosorbent assay (ELISA) was used to evaluate the C. trachomatis specific antibodies in serum. Polysorp® plates (NUNC A/S, Roskilde, Denmark) were coated with UV-inactivated C. trachomatis SvD elementary bodies (EBs) (4 μg/ml) over night at 4 °C. For blocking and dilution of secondary antibodies a PBS buffer with 1 % casein and 0.05 % Tween 20 was used. Chlamydia specific IgM, IgG and IgA were detected with HRP-conjugated antibodies; goat-anti-pig IgM (AAI39P, Serotec, UK in 1:10000), goat-anti-pig IgG∙Fc (AAI41P, Serotec, UK in 1:10000) and goat-anti-pig IgA (AAI40P, Serotec, UK in 1:2000). The reactions were visualized with TMB PLUS substrate (Kem-En-Tec, Taastrup, Denmark) and stopped with 0.5 M sulphuric acid. The plates were read on an ELISA reader at 450 nm with correction at 650 nm. Confirmed positive serum from an earlier study was included as a positive control and two wells were run without substrate as a negative control on each plate. Each sample was run in duplicates in serial dilutions. The positive control was used as an internal standard to correct for plate-to-plate variation. The corrected OD values are presented as the increase in OD-value on day x PI (3, 5 and 7 PI) compared to day 0 PI (∆ODday(x)PI = ODday(x)PI -ODday0PI). The dilution was 1:640 for IgM analyses and 1:10 for IgA and IgG analyses.

Statistical analyses

Statistical analyses were performed using GraphPad Prism 5. Differences in mean rectal temperatures were analysed with a Repeated measures ANOVA, using Tukey’s multiple comparison post test. Kruskal Wallis test was used with Dunn’s multiple comparison post test to compare plasma cell infiltrations. Spearman’s correlation was used for determining correlation between cox-2 and IL-8. A cut off value for elevated expression was used; corresponding to the mean value of inoculated animals +3 standard deviations, after a test for outliers was performed. A value of P < 0.05 was considered statistically significant.


Clinical signs and necropsy findings

All pigs remained clinically unaffected during the study period. As expected, all pigs developed signs of oestrus, which decreased over time, and on day 4 PI, vulvar erythema and oedema had resolved. The mean rectal temperature increased from 38.5 °C to 39.1 °C 6–9 h PI. On day 1 PI, the mean rectal temperature had returned to a normal level. The temperature variation was statistically significant (Additional file 1). All genital tracts exhibited oedematous endometria and slight to moderate hyperaemia of the broad ligament. One pig (day 3 PI) had a thin-walled cyst, 7 × 7 × 7 mm, with clear fluid, adjacent to the infundibulum in the mesosalpinx, considered to be a mesonephric duct remnant.


The oestral cycle stage was found to be peri-oestral in eight out of ten experimental animals (80 %), and in five out of six of the genital control organs (83 %) based on the histological appearance, while two pigs from day 7 PI, and one genital control organ were in dioestrus.

On day 3 PI, an increased number of mononuclear, lymphoid cells, of which some were positive for CD3, were present in the subepithelial stroma of the vagina and cervix of experimentally infected pigs (Fig. 2a, b). Perivascular infiltrates of lymphocytes, occasionally in large numbers were noted especially in the vagina. Perivascular infiltrates were not noted in any of the control tissues (Fig. 2d, f). Some of the mononuclear cells showed features of hydropic degeneration. Neutrophils were found in the epithelium and in the subepithelial stroma, predominantly perivascularly (Fig. 2c). Stromal oedema and dilated lymphatics were also noted (Fig. 2a). Mild to moderate amounts of cell debris, including sloughed epithelial cells, neutrophils and macrophages were present in the vaginal and cervical lumen. Slight amounts of luminal contents, primarily consisting of epithelial cells, were also found in the vagina and cervix of a single control pig. Chlamydial antigen was detected by IHC in epithelial cells and intracellularly in luminal debris in the vagina of two of the four pigs (Fig. 3 a, b, c), and in the cervix of one pig. Uterine changes were sparse, and consisted of small stromal clusters of mononuclear cells, and mild stromal infiltration of neutrophils. On day 5 PI, mild infiltrations of mononuclear cells were present subepithelially in the vagina and cervix (Fig. 2e), while perivascular infiltrations were found only in a single pig. A low number of mononuclear cells were noted in the uterine stroma. Chlamydial antigen was detected by IHC in two of three vaginal samples. On day 7 PI, there was a slight increase in diffuse lymphoid cell infiltrations in the vagina and cervix. Mild perivascular infiltrations were noted, and plasma cells were found in the subepithelial stroma. Chlamydial antigen was not detected in any of the control tissues by IHC (Fig. 3d).

Fig. 2

Histopathological changes in the lower genital tract. a Vagina, day 3 PI, haematoxylin and eosin (HE), showing subepithelial stromal and perivascular infiltrations of mononuclear, lymphoid cells, and dilated lymphatic vessels (*); b Vagina, day 3 PI (serial section of a): IHC staining of CD3 showing positive staining in some, but not all of the infiltrating cells (arrows); c Vagina, day 3 PI, HE, showing neutrophils extravasating in the subepithelial stroma (enlarged in insert, arrow); d Vagina, HE, control tissue; e Cervix, day 5 PI, HE, showing a dense subepithelial infiltrate of mononuclear cells (arrowhead); f Cervix, HE, control tissue

Fig. 3

IHC staining of Chlamydia. a Vagina, day 3 PI. Positive intracellular staining within a luminal accumulation of sloughed epithelial cells, neutrophils and macrophages; b Higher magnification of the high-lighted area in a) showing positively stained material intracellularly located; c Vagina, day 3 PI, showing an inclusion in a superficial epithelial cell (arrow); d Vagina from control tissue

Inoculated pigs showed elevated numbers of cox-2 and IL-8 positive cells in the vaginal epithelium (Figs. 4a-d and 5a, b). Expression of cox-2 and IL-8 was significantly correlated (Fig. 5c). In addition, samples with elevated levels of cox-2/IL-8 corresponded to samples positive for Chlamydia by IHC and/or q-PCR (Fig. 5a-c). Three of ten cervical samples had elevated levels of cox-2, and two samples exhibited elevated levels of IL-8.

Fig. 4

IHC staining of cox-2 and IL-8 in vaginal tissue from day 3 PI, and control tissues. a Vagina, day 3 PI. Positive staining in numerous superficial epithelial cells for cox-2 (arrows); b Vagina from control tissue, showing positive staining for cox-2 in single superficial epithelial cells (arrow); c Vagina, day 3 PI. Positive (red) staining in numerous superficial epithelial cells for IL-8 (arrows); d Vagina from control tissue showing positive staining for IL-8 in a single epithelial cell (arrow)

Fig. 5

Expression of cox-2 and IL-8 by epithelial cells in the vagina. Numbers of cox-2 (a) and IL-8 (b) expressing cells/mm epithelium of the uninoculated histological control tissues, compared to inoculated experimental animals. Cut off: mean of controls +3SD. c Correlation of cox-2 and IL-8 expression by vaginal epithelial cells (Spearman). The colours mark the samples testing positive for Chlamydia by either q-PCR and IHC (orange), q-PCR alone (green) or IHC alone (red)

Detection of C. trachomatis by culture and q-PCR

Culturing of vaginal swabs revealed replicating C. trachomatis on day 3 and 5 PI (Fig. 6a). Similarly, q-PCR identified C. trachomatis DNA in vaginal swabs on the same days (Fig. 6b). Both culture and q-PCR showed the highest amounts of Chlamydia on day 3 PI (Fig. 6a-b). Only a few samples were positive on day 7 PI. C. trachomatis DNA was detected by q-PCR in uterine samples on all three sampling days, however with a variation in distribution and amount (Table 2). Similar to the vaginal samples, most antigen was found on day 3 PI, with decreasing amounts detected on days 5 and 7 PI. Positive samples were also detected in the oviducts in individual pigs (Table 2).

Fig. 6

Detection of C. trachomatis in vaginal swabs. a cell culturing (shown as IFU/swab); b q-PCR (shown as ng of C. trachomatis/swab). Results are shown for single pigs

Table 2 Detection of C. trachomatis by q-PCR in different parts of the genital tract at days 3, 5 and 7 PI

Antibody-producing cells in the vagina and cervix

A tendency for increased numbers of IgM and IgA expressing cells was found in the vagina on all days PI compared to control tissues; however, the difference was only significant regarding IgA+ cells on day 7 PI (Fig. 7a-c). In the cervix, there were no differences in the number of antibody positive cells in the infected pigs compared to controls. A small amount of Chlamydia-specific antibodies of all three isotypes was detected in serum, predominantly of IgM isotype (Additional file 2).

Fig. 7

Numbers of IgM, IgA and IgG-expressing cells in the vagina, compared to control tissues. Positively stained cells were counted to a stromal depth of 100 μm from the basal epithelial layer, and measured as numbers of cells/mm2. a IgM b IgA and c IgG. Lines show medians. Statistics: Kruskal Wallis, Dunn’s multiple comparison post test


A novel model of human genital Chlamydia infection was evaluated in sexually mature Göttingen minipigs. Infection and the related tissue changes were primarily found in the lower genital tract, which is also the most common site of human chlamydial infections [34, 35]. In humans, the duration of a primary genital C. trachomatis infection is difficult to assess because up to 80 % of infected women are asymptomatic [36]. A follow-up study in women has shown spontaneous clearance in 18 % of detected cases, in 13 days from the time of sampling until treatment [37]. Although a time-dependent correlation of clearance was found, lack of knowledge remains about the host response following uncomplicated genital infection with C. trachomatis [38]. In addition, no systematic evaluations of the initial histopathologic changes have been reported from large animal studies of C. trachomatis pathogenesis.

In our study, the most striking histological changes were subepithelial clusters of numerous lymphoid cells in the vagina on day 3 PI. It is known from murine in vivo and human in vitro studies that natural killer (NK) cells are quickly activated and involved in IFN-y clearance of Chlamydia infections [39], thus a proportion of the infiltrating cells are thought to be of NK cell origin, further supported by the heterogenous expression of CD3 by the infiltrating lymphocytes (Fig. 2b). The CD3-positive cell population could consist of either NK-T cells [40], or unspecific CD4/CD8 T cells attracted to the site of inflammation. IHC staining of cox-2 and IL-8 showed positive staining in superficial vaginal and cervical epithelial cells in locations where cells positive for Chlamydia on IHC were also found (Fig. 5a-c). This corresponds to what is described in humans as IL-8 is secreted by Chlamydia-infected human cervical epithelial cells in vitro [23], and has further been shown to be up regulated in the cervicovaginal fluid of Chlamydia-infected women [41]. Similarly, cox-2 is an enzyme related to pro-inflammatory responses that can be induced in human cervico-vaginal cells as a response to toll-like receptor (TLR)-ligands and TNF-α, as demonstrated in an in vitro model of vaginal infection [26].

Neutrophils were found intraepithelially and within the subepithelial stroma, reflecting an ongoing innate immune response. Surprisingly, there were no neutrophils in immediate association to the chlamydial inclusions in the epithelium, as would have been expected with the observed increase in IL-8 expression, a well recognised neutrophil chemoattractant. However, positive Chlamydia staining was found intracellularly in luminally located clusters of epithelial cells, neutrophils and macrophages, indicating an innate immune reaction to the infection (Fig. 3a, b). Infiltration with neutrophils was one of the typical histological changes described in the intestine of Chlamydia-infected gnotobiotic piglets four days PI [42]. However, this feature was not consistently observed in association with chlamydial antigen, as described in the current study. In women, intraepithelial and intraluminal neutrophils have also been associated with various endometrial pathogens, including C. trachomatis [43, 44] indicating a similar host response in our C. trachomatis minipig model.

By detecting expression of IL-8 and cox-2 by epithelial cells, associated with chlamydial antigen, and with attendant infiltration of neutrophils and probable NK cells, we have demonstrated pro-inflammatory and innate immune responses in this novel experimental model. It is likely that these responses are responsible for the decreased shedding of bacteria observed within a week of inoculation. The innate immune response has previously been shown to clear C. trachomatis infection without involvement of the adaptive immune system in a murine model [45].

In the current study, a rapid decrease in the number of replicating bacteria in the vagina occurred within one week of inoculation. In addition, bacteria were detected by q-PCR in endometrial and oviduct samples, on all sampling days, although it was not possible to find inclusions by IHC in the more cranial regions of the genital tract. This could be due to a combination of a rapidly decreasing bacterial load and the sampling of an insufficient number of locations. This finding did not correlate with other porcine studies, in which replicating bacteria were detected in the genital tract of prepubertal pigs for up to 25 days following inoculation [13]. The observed differences may be explained by the different C. trachomatis serovars used, and also the sexual maturity of the pigs. It is known that sex hormones influence the innate and adaptive immune response of the female reproductive tract [20, 46], and the susceptibility of its epithelial cells to C. trachomatis [21, 47]. As chlamydial infections in women are most common in sexually mature women, the sexually mature Göttingen minipig constitutes a more comparable model of the human disease than models using sexually immature animals. Further optimisation, to establish a long term infection, are currently taking place in our laboratory. Future studies could also include repeated inoculations, as reinfection is one of the risk factors thought to be associated with an adverse outcome in Chlamydia infected women [2].

In the vagina, a tendency towards larger numbers of IgM+ and IgA+ cells were found, however the difference was only significant for IgA+ cells on day 7 PI (Fig. 7b). We cannot determine the antigenic specificity of these cells, but it is likely that they were recruited as a response to infection. Plasma cell infiltrates are one of the typical hallmarks of a chlamydial infection in women [48], and our results indicate a similar pattern in Chlamydia-infected pigs. We only detected a slight antigen specific antibody response in serum (Additional file 2), probably due to the early sampling points in relation to an initiation of a systemic adaptive response. Other studies by our group, using the same basic study design, have revealed a Chlamydia-specific adaptive immune response at day 12 PI [49], and an adaptive immune response following a genital Chlamydia infection has also been demonstrated using prepubertal pigs [14].

In this study, we included control specimens of age-matched, sexually mature gilts for the histological evaluation. These gilts were not subjected to the same procedures as the experimental gilts, including hormonally synchronisation, vaginal inoculation and swab sampling procedures. Therefore differences in handling may have caused discrepancies. However, as the majority of the genital tract organs from both the experimental and control groups were in peri-oestral stage, we consider the hormonal influences on the mucosa to be comparable between the groups. There is a risk of inducing changes to the mucosa following inoculation and sampling procedures due to mechanical disruption and reaction to the inoculum buffer solution. However, in earlier studies in mice sham-inoculated with SPG, no histological changes were detected in the genital tract (Erneholm, unpublished observation). Therefore, we do not think that SPG itself and/or the inoculation and sampling procedures would give rise to considerable changes in the genital tract of the pigs. In addition, the findings of increased levels of cox-2 and IL-8 in the experimental group were co-localised to areas with detection of chlamydial antigen, which further supports our hypothesis that this reaction is a consequence of the C. trachomatis infection.


A promising sexually mature minipig model of human genital C. trachomatis infection has been developed that generates comparable initial immune responses to those reported in human patients. The porcine model has several advantages to other animal models, as it is more comparable to humans than mice, and is cheaper and more accessible compared to NHP. Further studies using this model have the potential to generate further insights into the early pathogenesis of C. trachomatis infection.


  1. 1.

    World Health Organization: Global incidence and prevalence of selected curable sexually transmitted infections - 2008. World Health Organization; 2012. URL: Accessed 10 Mar 2015.

  2. 2.

    Haggerty CL, Gottlieb SL, Taylor BD, Low N, Xu F, Ness RB. Risk of sequelae after Chlamydia trachomatis genital infection in women. J Infect Dis. 2010;201:134–55.

    Article  Google Scholar 

  3. 3.

    Phillips RS, Hanff PA, Holmes MD, Wertheimer A, Aronson MD. Chlamydia trachomatis cervical infection in women seeking routine gynecologic care: criteria for selective testing. Am J Med. 1989;86:515–20.

    CAS  Article  PubMed  Google Scholar 

  4. 4.

    Vasilevsky S, Greub G, Nardelli-Haefliger D, Baud D. Genital Chlamydia trachomatis: understanding the roles of innate and adaptive immunity in vaccine research. Clin Microbiol Rev. 2014;27:346–70.

    Article  PubMed  PubMed Central  Google Scholar 

  5. 5.

    Bell JD, Bergin IL, Schmidt K, Zochowski MK, Aronoff DM, Patton DL. Nonhuman primate models used to study pelvic inflammatory disease caused by Chlamydia trachomatis. Infect Dis Obstet Gynecol. 2011;2011:7.

    Article  Google Scholar 

  6. 6.

    Meurens F, Summerfield A, Nauwynck H, Saif L, Gerdts V. The pig: a model for human infectious diseases. Trends Microbiol. 2012;20:50–7.

    CAS  Article  PubMed  Google Scholar 

  7. 7.

    Fairbairn L, Kapetanovic R, Sester DP, Hume DA. The mononuclear phagocyte system of the pig as a model for understanding human innate immunity and disease. J Leukocyte Biol. 2011;89:855–71.

    CAS  Article  PubMed  Google Scholar 

  8. 8.

    Dawson HD. A comparative assessment of the pig, mouse and human genomes. In: The Minipig in Biomedical Research. edn. Edited by McAnulty PA, Dayan AD, Ganderup N-C, Hastings KL. Florida: CRC Press, Taylor & Francis Group; 2012. p. 323-342.

  9. 9.

    Goldman JM, Murr AS, Cooper RL. The rodent estrous cycle: characterization of vaginal cytology and its utility in toxicological studies. Birth Defects Res B Dev Reprod Toxicol. 2007;80:84–97.

    CAS  Article  PubMed  Google Scholar 

  10. 10.

    Squier C, Mantz M, Schlievert P, Davis C. Porcine vagina ex vivo as a model for studying permeability and pathogenesis in mucosa. J Pharm Sci. 2008;97:9–21.

    CAS  Article  PubMed  Google Scholar 

  11. 11.

    D’cruz O, Erbeck D, Uckun F. A study of the potential of the pig as a model for the vaginal irritancy of benzalkonium chloride in comparison to the nonirritant microbicide PHI-443 and the spermicide vanadocene dithiocarbamate. Toxicol Pathol. 2005;33:465–76.

    Article  PubMed  Google Scholar 

  12. 12.

    Schautteet K, Stuyven E, Cox E, Vanrompay D. Validation of the Chlamydia trachomatis genital challenge pig model for testing recombinant protein vaccines. J Med Microbiol. 2011;60:117–27.

    CAS  Article  PubMed  Google Scholar 

  13. 13.

    Schautteet K, Stuyven E, Beeckman DS, Van Acker S, Carlon M, Chiers K, et al. Protection of pigs against Chlamydia trachomatis challenge by administration of a MOMP-based DNA vaccine in the vaginal mucosa. Vaccine. 2011;29:1399–407.

    CAS  Article  PubMed  Google Scholar 

  14. 14.

    Schautteet K, De Clercq E, Jonsson Y, Lagae S, Chiers K, Cox E, et al. Protection of pigs against genital Chlamydia trachomatis challenge by parenteral or mucosal DNA immunization. Vaccine. 2012;30:2869–81.

    CAS  Article  PubMed  Google Scholar 

  15. 15.

    Vanrompay D, Hoang TQ, De Vos L, Verminnen K, Harkinezhad T, Chiers K, et al. Specific-pathogen-free pigs as an animal model for studying Chlamydia trachomatis genital infection. Infect Immun. 2005;73:8317–21.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  16. 16.

    Peipert JF. Genital chlamydial infections. New Engl J Med. 2003;349:2424–30.

    CAS  Article  PubMed  Google Scholar 

  17. 17.

    Dyck GW, Swierstra EE. Growth of the reproductive tract of the gilt from birth to puberty. Can J Anim Sci. 1983;63:81–7.

    Article  Google Scholar 

  18. 18.

    Shen J, Hickey R, Forney LJ. Microbiome, vagina. In: Nelson KE, editor. Encyclopedia of metagenomics. New York: Springer; 2013.

    Google Scholar 

  19. 19.

    Kämmerer U, Rieger L, Kapp M, Dietl J, Ruck P. Immunocompetent cells in the endometrium of fetuses and children. Hum Repro. 2003;18:969–75.

    Article  Google Scholar 

  20. 20.

    Wira CR, Fahey JV, Rodriguez-Garcia M, Shen Z, Patel MV. Regulation of mucosal immunity in the female reproductive tract: the role of sex hormones in immune protection against sexually transmitted pathogens. Am J Reprod Immunol. 2014;72:236–58.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  21. 21.

    Guseva N, Knight S, Whittimore J, Wyrick P. Primary cultures of female swine genital epithelial cells in vitro: a new approach for the study of hormonal modulation of Chlamydia infection. Infect Immun. 2003;71:4700–10.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  22. 22.

    Maslow AS, Davis CH, Choong J, Wyrick PB. Estrogen enhances attachment of Chlamydia trachomatis to human endometrial epithelial cells in vitro. Am J Obstet Gynecol. 1988;159:1006–14.

    CAS  Article  PubMed  Google Scholar 

  23. 23.

    Rasmussen SJ, Eckmann L, Quayle AJ, Shen L, Zhang YX, Anderson DJ, et al. Secretion of proinflammatory cytokines by epithelial cells in response to Chlamydia infection suggests a central role for epithelial cells in chlamydial pathogenesis. J Clin Invest. 1997;99:77–87.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  24. 24.

    Laursen H, Jensen HE, Leifsson PS, Jensen LK, Christiansen JG, Trebbien R, et al. Immunohistochemical detection of interleukin-8 in inflamed porcine tissues. Vet Immunol Immunopathol. 2014;159:97–102.

    CAS  Article  PubMed  Google Scholar 

  25. 25.

    Jana B, Kozlowska A, Koszykowska M, Majewski M. Expression of cyclooxygenase-2 in the inflammatory changed porcine uterus. Pol J Vet Sci. 2009;12:1–8.

    CAS  PubMed  Google Scholar 

  26. 26.

    Joseph T, Zalenskaya IA, Yousefieh N, Schriver SD, Cote LC, Chandra N, et al. Induction of cyclooxygenase (COX)-2 in human vaginal epithelial cells in response to TLR ligands and TNF-a. Am J Reprod Immunol. 2012;67:482–90.

    CAS  Article  PubMed  Google Scholar 

  27. 27.

    Olsen AW, Follmann F, Jensen K, Hojrup P, Leah R, Sorensen H, et al. Identification of CT521 as a frequent target of Th1 cells in patients with urogenital Chlamydia trachomatis infection. J Infect Dis. 2006;194:1258–66.

    CAS  Article  PubMed  Google Scholar 

  28. 28.

    Hansen J, Jensen KT, Follmann F, Agger EM, Theisen M, Andersen P. Liposome delivery of Chlamydia muridarum major outer membrane protein primes a Th1 response that protects against genital chlamydial infection in a mouse model. J Infect Dis. 2008;198:758–67.

    CAS  Article  PubMed  Google Scholar 

  29. 29.

    Olsen AW, Theisen M, Christensen D, Follmann F, Andersen P. Protection against Chlamydia promoted by a subunit vaccine (CTH1) compared with a primary intranasal infection in a mouse genital challenge model. PLoS One. 2010;5:e10768.

    Article  PubMed  PubMed Central  Google Scholar 

  30. 30.

    Bollen P, Hansen AJK, Alstrup AKO. The laboratory swine. 2nd edn. Florida: CRC Press, Taylor & Francis; 2010.

  31. 31.

    Jensen HME. Necropsy: a handbook and atlas. Denmark: Biofolia; 2011.

  32. 32.

    de Rijk E, van den Brink H, Lensen J, Lambregts A, Lorentsen H, Peter B. Estrous cycle-dependent morphology in the reproductive organs of the female Göttingen minipig. Toxicol Pathol. 2014;42:1197–211.

    Article  PubMed  Google Scholar 

  33. 33.

    Kaeoket K, Persson E, Dalin AM. Corrigendum to “The sow endometrium at different stages of the oestrus cycle: studies on morphological changes and infiltration by cells of the immune system”. Anim Reprod Sci. 2002;73:89–107. Anim. Reprod. Sci. 65 (2001) 95–114.

    CAS  Article  PubMed  Google Scholar 

  34. 34.

    van Valkengoed IG, Morré SA, van den Brule AJ, Meijer CJ, Bouter LM, Boeke AJP. Overestimation of complication rates in evaluations of Chlamydia trachomatis screening programmes—implications for cost-effectiveness analyses. Int J Epidemiol. 2004;33:416–25.

    Article  PubMed  Google Scholar 

  35. 35.

    Paavonen J, Eggert-Kruse W. Chlamydia trachomatis: impact on human reproduction. Hum Reprod Update. 1999;5:433–47.

    CAS  Article  PubMed  Google Scholar 

  36. 36.

    Zimmerman HL, Potterat JJ, Dukes RL, Muth JB, Zimmerman HP, Fogle JS, et al. Epidemiologic differences between chlamydia and gonorrhea. Am J Public Health. 1990;80:1338–42.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  37. 37.

    Geisler WM, Wang C, Morrison SG, Black CM, Bandea CI, Hook EWI. The natural history of untreated Chlamydia trachomatis infection in the interval between screening and returning for treatment. Sex Transm Dis. 2008;35:119–23.

    Article  PubMed  Google Scholar 

  38. 38.

    Geisler WM. Duration of untreated, uncomplicated Chlamydia trachomatis genital infection and factors associated with Chlamydia resolution: a review of human studies. J Infect Dis. 2010;201:104–13.

    Article  Google Scholar 

  39. 39.

    Tseng C-TK, Rank RG. Role of NK cells in early host response to chlamydial genital infection. Infect Immun. 1998;66:5867–75.

    CAS  PubMed  PubMed Central  Google Scholar 

  40. 40.

    Peng Y, Zhao L, Shekhar S, Liu L, Wang H, Chen Q, et al. The glycolipid exoantigen derived from Chlamydia muridarum activates invariant natural killer T cells. Cell Mol Immunol. 2012;9:361–6.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  41. 41.

    Masson L, Mlisana K, Little F, Werner L, Mkhize NN, Ronacher K, et al. Defining genital tract cytokine signatures of sexually transmitted infections and bacterial vaginosis in women at high risk of HIV infection: a cross-sectional study. Sex Transm Infect. 2014;90:580–7.

    Article  PubMed  Google Scholar 

  42. 42.

    Rogers DG, Andersen AA. Intestinal lesions caused by two swine chlamydial isolates in gnotobiotic pigs. J Vet Diagn Invest. 1996;8:433–40.

    CAS  Article  PubMed  Google Scholar 

  43. 43.

    Kiviat NB, Wølner-Hanssen P, Eschenbach DA, Wasserheit JN, Paavonen JA, Bell TA, et al. Endometrial histopathology in patients with culture-proved upper genital tract infection and laparoscopically diagnosed acute salpingitis. Am J Surg Pathol. 1990;14:167–75.

    CAS  Article  PubMed  Google Scholar 

  44. 44.

    Ficarra M, Ibana JSA, Poretta C, Ma L, Myers L, Taylor SN, et al. A distinct cellular profile is seen in the human endocervix during Chlamydia trachomatis infection. Am J Reprod Immunol. 2008;60:415–25.

    Article  PubMed  PubMed Central  Google Scholar 

  45. 45.

    Sturdevant GL, Caldwell HD. Innate immunity is sufficient for the clearance of Chlamydia trachomatis from the female mouse genital tract. Pathog Dis. 2014;72:70–3.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  46. 46.

    Hickey DK, Patel MV, Fahey JV, Wira CR. Innate and adaptive immunity at mucosal surfaces of the female reproductive tract: stratification and integration of immune protection against the transmission of sexually transmitted infections. J Reprod Immunol. 2011;88:185–94.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  47. 47.

    Wan C, Latter JL, Amirshahi A, Symonds I, Finnie J, Bowden N, et al. Progesterone activates multiple innate immune pathways in Chlamydia trachomatis-infected endocervical cells. Am J Reprod Immunol. 2014;71:165–77.

    CAS  Article  PubMed  Google Scholar 

  48. 48.

    Kiviat NB, Paavonen JA, Wølner-Hanssen P, Critchlow CW, Stamm WE, Douglas J, et al. Histopathology of endocervical infection caused by Chlamydia trachomatis, herpes simplex virus, Trichomonas vaginalis, and Neisseria gonorrhoeae. Human Pathol. 1990;21:831–7.

    CAS  Article  Google Scholar 

  49. 49.

    Boje S, Olsen AW, Erneholm K, Agerholm JS, Jungersen G, Andersen P, et al. A multi-subunit Chlamydia vaccine inducing neutralizing antibodies and strong IFN-gamma CMI responses protects against a genital infection in minipigs. Immunol Cell Biol. 2015;94:185–95.

    Article  PubMed  PubMed Central  Google Scholar 

Download references


We wish to thank Maria Rathmann Sørensen for help with q-PCR analyses, and the laboratory technicians Vita Skov, Betina Gjedsted Andersen, Elisabeth Petersen, Anne Dorte Roed and Heidi Elise Holm for assistence in the laboratory, during the experiment and for preparation of histological sections


The histological control tissues were kindly provided by Ellegaard Göttingen Minipigs A/S. The study was financially supported by Aase and Ejnar Danielsen’s Foundation, and Innovation Fund Denmark (069-2011-1). The funding bodies had no role in the treatment of data or writing of manuscript.

Availability of data and materials

The datasets analysed during the current study can be available from the corresponding author on reasonable request.

Authors’ contributions

KE designed the study, did the major part of the experimental work, data analyses and drafted the manuscript. EL and SB participated in the experimental work, acquisition and interpretation of data. AWO, PA, FF, JPC were involved in the conception of the study, interpretation of data and critical revision of the manuscript. HEJ and JSA participated in the design of the study, interpretation of data and the draft of the manuscript. All authors read and approved the final manuscript.

Competing interests

The authors declare that they have no competing interests.

Consent for publication

Not applicable.

Ethics approval and consent to participate

The experiment was conducted with permission from the Danish Animal Experiments Inspectorate of the Danish Veterinary and Food Administration, license no: 2008/561–1581.

Author information



Corresponding author

Correspondence to Karin Erneholm.

Additional files

Additional file 1:

Body temperatures (oC). Data show mean rectal temperatures and whiskers represent 95 % confidence intervals. At day 0, the mean temperature was significantly increased compared to all other time points. (PDF 47 kb)

Additional file 2:

Serum antibodies. Detection of serum antibodies against C. trachomatis, measured as the difference in OD values day (x) and day 0. (PDF 57 kb)

Rights and permissions

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (, which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver ( applies to the data made available in this article, unless otherwise stated.

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Erneholm, K., Lorenzen, E., Bøje, S. et al. Genital tract lesions in sexually mature Göttingen minipigs during the initial stages of experimental vaginal infection with Chlamydia trachomatis serovar D. BMC Vet Res 12, 200 (2016).

Download citation


  • Chlamydia
  • Sexually mature
  • Pig model
  • Porcine
  • Genital tract
  • Initial lesions