Skip to main content

Table 1 Primer used for qPCR

From: Expression of genes involved in the T cell signalling pathway in circulating immune cells of cattle 24 months following oral challenge with Bovine Amyloidotic Spongiform Encephalopathy (BASE)

Gene Function Sequence
TCR delta chain Antigen receptor of T cells Forward 5′TCGCTTGTTTGGTGAAGGA
Reverse 5′CCCAGGTGAGATGGCAATAG
TRAT1 TCR associated membrane adapter 1: TCR-mediated T cell activation cascade Forward 5′GTGAACAAACTGCAAGACGC
Reverse 5′CTGGGCTTTCTTCGCTTCC
CD3E Marker of thymocytes and peripheral T lymphocytes Forward 5′TCTGGGACTCTGCCTCTTATTA
Reverse 5′CAAACTCTCTAGGGCATGTCAG
LAT Linker for activation of T cells, transduction of the activation signal downstream CD3 Forward 5′GGAGTCGGGAATATGTGAATGT
Reverse 5′CTGGGAATTCTGGGTGTCAG
ZAP70 Associated with CD3Z chain; transduction of the activation signal downstream CD3 Forward 5′CTCATGGCTGACATCGAACT
Reverse 5′CCACGTCGATCTGCTTCTT
LCK lymphocyte-specific protein tyrosine kinase Forward 5′GACAGCACCAGAAGCCATTA
Reverse 5′GCGACCATGAGTGACAATCT
B2MG Beta-2-microglobulin precursor Forward 5′CAGCGTCCTCCAAAGATTCA
Reverse 5′ACCCATACACATAGCAGTTCAG
ACTB Beta-Actin Forward 5′AGTCCTTTGCCTTCCCAAAA
Reverse 5′AAGCGATCACCTCCCCTGT
  1. B2MG and ACTB were used as internal controls.