C. pseudotuberculosisstrains and culture conditions
The previously obtained C. pseudotuberculosis CP09 mutant strain [7], the T1 pathogenic wild-type parental strain [11], and the caprine-pathogenic strain MIC-6 from the Laboratory of Genetics and Control of Microorganisms (Belo Horizonte, Brazil) bacterial collection were employed in this work. Strains were aerobically grown in “Brain Heart Infusion” broth (BHI, Oxoid) at 37°C. Kanamycin (kanamycin sulphate 25 μg/mL; Sigma-Aldrich, USA) was added to the mutant growth media. T1 and MIC-6 strains were isolated from caseous lesions of goats and have previously been employed in vaccination trials using goats and mice [11],[12].
Bacterial interaction assays with murine J774 cells
Pre-macrophagic J774 cells from murine lymphomas were cultivated in Dulbecco’s modified Eagle’s essential medium (DMEM, Sigma-Aldrich, USA) supplemented with 5% foetal bovine serum, 50 μg/mL gentamicin and 2.5 μg/mL fungizone at 37°C in a 5% CO2 atmosphere. The CP09 mutant strain and T1 wild-type strain were grown for 48 hours at 37°C and washed three times with PBS, resuspended in DMEM to a concentration of 106 CFU/mL, and used to infect J774 cells (multiplicity of infection [MOI]: 10 bacteria: 1 cell) grown to approximately 95% confluence in 24-well tissue culture plates.
For determination of intracellular viable bacteria, after 1, 3 and 6 hours of incubation, infected J774 monolayers were washed six times with PBS and treated with 150 μg/mL gentamicin sulphate (Sigma-Aldrich, USA) diluted in DMEM for 1 h. The number of intracellular bacteria was determined by viable counts after lysis of monolayers with 0.5 mL of 0.1% TritonX-100 (Sigma-Aldrich, USA) in PBS.
DNA extraction and PCR reaction
C. pseudotuberculosis genomic DNA was obtained from the T1 strain as previously described [13]. Briefly, 5.0 mL of the bacteria cultured in BHI broth was centrifuged and resuspended in 50 mM EDTA with 10 mg/mL lysozyme, and the Wizard® Genomic DNA Purification Kit (Promega, EUA) was used following the manufacturer’s instructions. After DNA extraction, the material was resolved by electrophoresis on a 1.0% agarose gel and quantified. Eluted DNA was stored at −20°C pending PCR amplification.
PCR was performed using the Go Taq® Green Master Mix Kit (Promega, EUA), with the objective to amplify the cp40 gene (accession number NC_014329.1NCBI). The primers used in the PCR assay were CP40F (5´ CGCGGATCCATGCATAATTCTCCTCGATCAG 3’) and CP40R (5’ CGGGAATTCTTATCTAG AACCAGTTGGCTTTC 3’), which contain BamHI and EcoRI restriction sites, respectively. Each PCR reaction had a final volume of 50 μL, with 25 μL from the kit, 1 μL of each primer (100 μM), 22 μL of ultra-purified water and 1 μL of genomic DNA from C. pseudotuberculosis strain T1. The amplification reaction consisted of an initial denaturation step at 94°C for 2 min, 35 cycles of denaturation for 1 min at 94°C, primer hybridisation for 1 min at 55°C and extension at 72°C for 1.5 min, followed by a final extension at 72°C for 10 min. The reaction was conducted in a thermocycler (Mastercycler Gradient, Eppendorf, Germany), and the final product was analysed by electrophoresis on a 1% agarose gel with GelRed™ (Biotium, USA) staining.
Cloning and recombinant protein production and purification
Cloning, recombinant protein production and protein purification were performed as previously described [13]. The pAE vector [14] and the amplified cp40 gene were digested using BamHI and EcoRI restriction enzymes (Fermentas, USA). After that, the cp40 gene was inserted into the pAE vector using the T4 DNA ligase enzyme (Fermentas, USA), and electrocompetent TOP 10 E. coli cells were transformed by electroporation. The transformed bacteria were cultivated in Luria-Bertani (LB) broth with 100 μg/mL ampicillin for 16 h, and the recombinant plasmid was purified using a MiniPrep Kit (Qiagen, USA). The pAE/CP40 recombinant plasmid was transformed by thermal shock in E. coli BL21, and the recombinant bacteria were cultivated in LB broth containing 1 mM IPTG for 3 h at 37°C in an orbital shaker.
For recombinant protein purification, the bacteria resulting from a large-scale culture (500 mL) were pelleted by centrifugation and resuspended in a washing buffer (200 mM NaH2PO4; 500 mM NaCl, 5 mM Imidazole; 8 M Urea pH 8.0) with 100 mg/mL lysozyme, sonicated five times for fifteen seconds (20 KHz) and maintained under agitation at 4°C for 16 h. The recombinant protein was purified using the HisTrapTM HP (GE Healthcare, USA) affinity chromatography column followed by dialysis in a cellulose tube-based system (Sigma, USA).
Animal model
Six- to eight-week-old BALB/c mice, a strain which is susceptible to C. pseudotuberculosis infection [1], were employed in this assay. For immunity tests, fifty mice were kept in a vivarium under suitable conditions of temperature and humidity with a 12 h light/dark cycle; food and water were provided ad libitum. The study was approved by the Ethics Committee for Animal Experimentation of the Tiradentes University (protocol number 010413).
Immunisation protocol, challenge and determination of the protection level
The rCP40 recombinant protein and CP09 live recombinant strain were used in vaccine formulations. Animals were divided into five groups (n = 10 each) and immunised intraperitoneally (i.p.) and/or subcutaneously (s.c.) on days 0 and 15. The administration routes followed what was previously described for recombinant proteins and mutant strains immunisation protocols [7],[8],[10]. The negative control group (G1) was inoculated i.p. with 100 μL of saline solution (0.9% NaCl). The G2 group was inoculated i.p. with 200 μL of a solution containing rCP40 (50 μg) and saponin (7.5 μg) in sterile saline solution. G3 was inoculated s.c. with 100 μL of the CP09 recombinant live strain (106 CFU). G4 was inoculated i.p. with 200 μL of a solution containing rCP40 (50 μg) and saponin (7.5 μg) and s.c. with 100 μL of the recombinant live CP09 strain (106 CFU). Group G5 used a heterologous prime-boost strategy and was first inoculated i.p. with 200 μL of rCP40 (50 μg) and saponin (7.5 μg) in solution followed by an s.c. booster dose of 100 μL of the live recombinant strain CP09 (106 CFU) 15 days after the first vaccination.
The previously immunised animals were challenged with 104 CFU/mL (i.p.) of the MIC-6 virulent strain thirty days after the last immunisation. The protection conferred was assessed according to the survival rate of the animals immunised with different vaccine formulations. The animals were observed daily, and mortality was recorded over four weeks following the challenge.
Blood collection and ELISA for specific IgG determination
Animals were bled at days 0, 15, 30, 45 and 60 post-immunisation to determine the antibody levels. Blood was collected from the retro-orbital sinus with Pasteur pipettes. All blood collections were performed under anaesthesia with ketamine 10% (1 mL/kg) and xylazine 2% (0.1 mg/kg) (Agener União Saúde Animal, Brazil), and all efforts were made to minimise suffering. After coagulation, blood was centrifuged at 1,500 g for 10 min. Serum was removed and stored at −20°C.
Sera samples from the immunised mice were used in immunoassays (ELISA) for detection of specific IgG1, IgG2a and IgG3 antibodies. For this purpose, polystyrene 96-well plates (Greiner, USA) were coated with 100 μL of C. pseudotuberculosis T1 strain supernatant diluted 1:100 [15] (for G3 sera samples) or 0.125 ug/mL of rCP40 (for G2 sera samples) or a combination of both antigens (for G4 and G5 sera samples). All antigen dilutions were made in bicarbonate-carbonate buffer (pH 9.6). Plates were incubated at 4°C for 18 h. After this period, plates were washed twice with PBS-T (1X PBS, pH 7.4, 0.05% Tween 20) and blocked with 200 μL/well of 5% defatted milk in PBS-T for 2 h at 37°C. After this blocking step, the wells were washed five times with PBS-T and then 100 μL/well of sera samples from mice diluted 1:100 in PBS-T were added in duplicate. After one hour of incubation at 37°C and five washes with PBS-T, 50 μL/well of an anti-mouse antibody against IgG1, IgG2a or IgG3 (Invitrogen Life Technologies, USA) diluted 1:5000 was added. The plates were again incubated for 45 min at 37°C and then washed five times with PBS-T. After the washes, 50 μL/well of TMB developing solution (10 mL citric-phosphate buffer pH 5.1, 4 mg of orthophenylenediamine, 4 μL of H2O2) was added. The reaction was stopped by adding 25 μL of 4 N H2SO4. The absorbance was measured at 450 nm using an ELISA reader (Thermo Plate TP Reader, Thermo, USA).
Statistical analysis
Statistical analyses were performed using GraphPad Prism version 6.0 for Windows (GraphPad Software, USA). The results of intracellular viability and specific immunoglobulins production were expressed as the means ± standard deviations. Differences between IgG production in the different groups were calculated by one-way ANOVA followed by the Tukey post-test test. The data were considered statistically significant when p < 0.05.
