Skip to main content

Table 2 Primers used for Brucella identification

From: Brucella spp. distribution, hosting ruminants from Greece, applying various molecular identification techniques

Primer Name Primer sequence (5΄-3΄) Size of product (bp)a Annealing temperature Reference
Bruce06F ATGGGATGTGGTAGGGTAATCG 274, 408, 542a 51oC Le Flèche et al. [30]
Bruce06R GCGTGACAATCGACTTTTTGTC
Bruce08F ATTATTCGCAGGCTCGTGATTC 330, 348, 366a 51oC Le Flèche et al. [30]
Bruce08R ACAGAAGGTTTTCCAGCTCGTC
Bruce11F CTGTTGATCTGACCTTGCAACC 509, 257, 383a 51oC Le Flèche et al. [30]
Bruce11R CCAGACAACAACCTACGTCCTG
Bruce12F CGGTAAATCAATTGTCCCATGA 345, 392, 375a 51oC Le Flèche et al. [30]
Bruce12R GCCCAAGTTCAACAGGAGTTTC
Bruce42F CATCGCCTCAACTATACCGTCA 538, 539, 289a 51oC Le Flèche et al. [30]
Bruce42R ACCGCAAAATTTACGCATCG
Bruce43F TCTCAAGCCCGATATGGAGAAT 170, 182, 182a 51oC Le Flèche et al. [30]
Bruce43R TATTTTCCGCCTGCCCATAAAC
Bruce45F ATCCTTGCCTCTCCCTACCAG 187, 151, 151a 51oC Le Flèche et al. [30]
Bruce45R CGGGTAAATATCAATGGCTTGG
Bruce55F TCAGGCTGTTTCGTCATGTCTT 234, 273, 273a 51oC Le Flèche et al. [30]
Bruce55R AATCTGGCGTTCGAGTTGTTCT
27F AGAGTTTGATCMTGGCTCAG 1412 50oC Frank et al. [53]
1492R TACGGY TACCTTGTTACGACTT
BP26F GCCCCTGACATAACCCGCTT 1029 58oC Gupta et al. [54]
BP26R GAGCGTGACATTTGCCGATA
OMP31F TGACAGACTTTTTCGCCGAA 720 55oC Vizcaino et al. [55]
OMP31R TATGGATTGCAGCACCGC
  1. aProducts are size-specific for B. suis, B. melitensis and B. abortus, respectively