Skip to main content

Table 1 Primers used in this study

From: Characterization and reverse genetic establishment of cattle derived Akabane virus in China

Number Name Sequences Located sites (bp)
1 AKAV-S-F AGTAGTGAACTCCACTATTAACTACGC 1-27
2 AKAV-S-R AGTAGTGTGCTCCACTAATTAACTATAAAC 827-856
3 AKAV-M1-F AGTAGTGAACTACCACAACAAAATGATT 1-28
4 AKAV-M1-R CTTGTATGCAAGCACTAAAAGC 1409-1432
5 AKAV-M2-F CTAGATAATTTCACATCTCATTGCC 1253-1277
6 AKAV-M2-R TTTACTCTGGAAATAACTGTTGCTTC 3182-3207
7 AKAV-M3-F CAAGATTCAAGACAGCTACATAAC 2830-2853
8 AKAV-M3-R AGTAGTGTTCTACCACAACAAATAATTATT 4280-4309
9 AKAV-L1-F AGTAGTGTACCCCTAAATACAACATAC 1-27
10 AKAV-L1-R CATATTTGGCTTTGATAATATCTTGTCAAC 1399-1428
11 AKAV-L2-F CGAAGCTATAAAAATTGGTACCTC 1167-1190
12 AKAV-L2-R CCATCTCCAGGTTCGCTAATCATCTCATCTG 2975-3005
13 AKAV-L3-F CGAGCATATACTCCAAGTCATGAAAAATC 2808-2836
14 AKAV-L3-R TCATTCCGTTACGATCCATTTG 4777-4798
15 AKAV-L4-F GAAGACCTTTGTTGAGACGTATCGACAG 4520-4647
16 AKAV-L4-R GCATCAATTTTGAAAGATCTATACCCCC 6040-6097
17 AKAV-L5-F GGATAGAATAGAAATGCTCAATATCG 5937-5962-
18 AKAV-L5-R AGTAGTGTGCCCCTAAATGCAATAATATAC 6839-6868
19 rAKAV-S-F GGGGTACCCGTCTCATATAGAGTAGTGAACTCCACTATTAACTACGC 1-27
20 rAKAV-S-R GCTCTAGACGTCTCTACCCAGTAGTGTGCTCCACTAATTAAC 834-856
21 rAKAV-M-F GGGGTACCCGTCTCATATAGAGTAGTGAACTACCACAACAAAATG 1-25
22 rAKAV-M-R GCTCTAGACGTCTCTACCCAGTAGTGTTCTACCACAACAAATAATT 4283-4309
23 rAKAV-L-F GGGGTACCCGTCTCATATAGAGTAGTGTACCCCTAAATACAACATAC 1-27
24 rAKAV-L-R GCTCTAGACGTCTCTACCCAGTAGTGTGCCCCTAAATGCAATAATATAC 6838-6868