Skip to main content

Table 6 Sequences of oligonucleotide primers and probes used in real-time PCR

From: Incidence of Brucella infection in various livestock species raised under the pastoral production system in Isiolo County, Kenya

Target Gene target Forward primer Reverse primer Probe Labels Reference
Genus
Brucella
bcsp31 gene 5’GCTCGGTTGCCAATATCAATGC3’ 5’GGGTAAAGCGTCGCCAGAAG3’ 5’AAATCTTCCACCTTGCCCTTGCCATCA3’ 5’Fluorophore-6-FAM,
3’Quencher BHQ1
[42]
B. abortus alkB gene 5’GCGGCTTTTCTATCACGGTATTC3’ 5’CATGCGCTATGATCTGGTTACG3’ 5’CGCTCATGCTCGCCAGACTTCAATG3’ 5’HEX
3’BHQ1
[42]
B. melitensis BMEI1162 gene 5’AACAAGCGGCACCCCTAAAA3’ 5’CATGCGCTATGATCTGGTTACG3’ 5’CAGGAGTGTTTCGGCTCAGAATAATCCACA3’ 5’Texas Red
3’BHQ2
[42]