Skip to main content

Table 3 Primers for PSV detection and complete VP1 gene amplification

From: Characterization of porcine sapelovirus prevalent in western Jiangxi, China

Primer name Oligonucleotide sequence (5′-3′)c Genome location
PSV-rFa CGTGCTCCTTTGGTGATTC 211-229d
PSV-rRb GAAAGAGTAGTAGTAGATTCC 460-480d
PSV-VP1-I-R TGTRAANGANCCYCTRTCAAA 3245-3265d/2788-2808e/3207-3227f
PSV-VP1-E-R CTCCARTTRTTDGCWGCRTGGTAGGG 3299-3324d/2842-2867e/3261-3286f
PSV-VP1-A-I-F CCACCDGGHGCMCCNTCHACATG 2180-2202d
PSV-VP1-A-E-F ACAYTDTCWTAYAAYGGRTGGGT 2126-2148d
PSV-VP1-B-I-F AGTGCDKCRGAYAAYTTTGT 1765-1784e
PSV-VP1-B-E-F TRTCRTAYAATGGRTGGGT 1673-1691e
PSV-VP1-C-I-F ACAGTKAGYGCTKCRGACAACTTTG 2202-2226f
PSV-VP1-C-E-F TTCCARCARACWGCACTDGTTGT 2142-2164f
  1. a F: forward primer
  2. b R: reverse primer
  3. cR, A or G; Y, C or T; W, A or T; N, A, T, G, or C; D, A, G, or T; K, G or T; H, A, C, or T; M, A or C
  4. d Location of primers relative to the complete genomic sequence of PSV-JD2011 (GenBank # KF539414)
  5. e Location of primers relative to the complete genomic sequence of PSV-HuN1 (GenBank # KX354740)
  6. f Location of primers relative to the complete genomic sequence of PSV-V13 (GenBank # AF406813)