Skip to main content

Table 2 The primers used for real-time PCR

From: The antiviral activity of kaempferol against pseudorabies virus in mice

Gene name Primer sequence (5’→3’) Tm (℃)
β-actin F: GGCTGTATTCCCCTCCATCG
R: CCAGTTGGTAACAATGCCATGT
62
EPO F: GGGTGTGAACTATATCGACACGTC
R: TCAGAGTCAGAGTGTGCCTCG
62
IE180 F: CATCGTGCTGGACACCATCGAG
R: ACGTAGACGTGGTAGTCCCCCA
62
LAT F: GGCAGCAGGACTACTGTCA
R: GTCTTGGTGGGAAGAAGTA
62
TK F: ATGACGGTCGTCTTTGACCGCCAC
R: CGCTGATGTCCCCGACGATGAA
60
  1. F forward primer, R reverse primer