Skip to main content

Table 1 The primers and sequencing used for PCR

From: Ocular tuberculosis in a calf.

Primers Sequence (5′ → 3′) Reference
16S-F TTGGAGAGTTTGATCMTGGCTC [10]
16S-R GTATTACCGCGGCTGCTG
MPB70-F GAACAATCCGGAGTTGACAA [11]
MPB70-R AGCACGCTGTCAATCATGTA
M22 -F GAACAATCCGGAGTTGACAA [11]
M22-R CGTTGGCCGGGCTGGTTTGGCC
RD9- F GTGTAGGTCAGCCCCATCC [12]
RD9-I CAATGTTTGTTGCGCTGC
RD9 -R GCTACCCTCGACCAAGTGTT
RD4-F ATGTGCGAGCTGAGCGATG [13]
RD4-I TGTACTATGCTGACCCATGCG
RD4-R AAAGGAGCACCATCGTCCAC