Skip to main content

Table 1 List of primers and amplified genes

From: Genetic characterization of highly pathogenic avian influenza A (H5N8) virus isolated from domestic geese in Iraq, 2018

Primer name sequences Gene Purpose Amplicon Reference Reference strain
M30F2/08F ATGAGYCTTYTAACCGAGGTCGAAACG M Detection of AIV type A 244 [34] 26–52
M264R3/08R TGGACAAANCGTCTACGCTGCAG M Detection of AIV type A [34] 267 − 245
HA5-1 F AAAGTGATCAGATYTGCATTG HA Sequencing 420 [20] 44–64
HA5-1R TGGTATGGRCATGCTGAGCTCA HA Sequencing [20] 440–461
H5-2 F TCATTTTGAGAAGATTCTGATCATCC HA Sequencing 754 This study 375–400
H5-2R CCCCTGCTCATTGCTATGGT HA Sequencing This study 1128 − 1109
H5-3 F GGCAACGTGGAAGAATGGAC HA Sequencing 744 This study 617–636
H5-3R ACTCGAAACAACCGTTACCC HA Sequencing [34] 1360 − 1341
H5-4 F CATCCACCCTCTCACCATCG HA Sequencing   [20] 927–968
H5-4R GCGATCCATTGGAGCACATC HA Sequencing   [20] 1681 − 1662
NA8-1 F AATAATGACCGTTGGCTCCA NA Detection & sequencing 616 This study 18–37
NA8-1R AGTAGGCACCCCTCCGTAAT NA This study 633 − 614
NA8-2 F AAGTGGATGGCGATTGGTGT NA Sequencing 403 This study 567–586
NA8-2R TGGGCAACCCTGCACATAAA NA Sequencing This study 969 − 950
\