Skip to main content

Table 2 The sequences of the primers and probes of the four swine diseases

From: Multiplex and on-site PCR detection of swine diseases based on the microfluidic chip system

The amplification gene. 5′ → 3′ Sequence
PRRSV-ORF1b gene F1: GCCTGACTAAGGAGCAGTGTTTA
R2: ACCGCTGTCTCAGTAACAACTAAGC
P3: CCGCGACCACAGCGGGTCA
PCV2-ORF1 gene F: TGGAGAGCGGGAGTCTGGT
R: CTTCCAATCACGCTTCTGCAT
P: ACCGTTGCAGAGCAGCACCCTGT
PEDV-Spike protein gene F: TCGCAATCTCAGCGTTATGGT
R: GGTGCTGCCTGTACCAGAGAGA
P: TGTGGTGGTGATGGCGAGCACAT
PRV-E (gE) gene F: TTGTGCTGGCGCTGGGCTCCT
R: CGACGCGATCTACGTGGAC
P: CACAGCACGCAGAGCCAGA
  1. F the forward primer, R the reverse primer, P the probe