Skip to main content

Table 1 Primers and probes used for PCR-based assays for detection of the germline APC variant

From: PCR-based genotyping assays to detect germline APC variant associated with hereditary gastrointestinal polyposis in Jack Russell terriers

  Sequence   Product size (bp)
Primers used for PCR-direct sequencing
 Primers sense 5′- AGTCCCACCTTCAAAAATCC −3’ 385
antisense 5′- AACTAAAAATGCAATTATCTTGAATG −3’
Primers used for PCR-RFLP and PCR-directsequencing of FFPE samples
 Primers sense 5′- TCTTTTGGCATTGTGTAAACTTG −3’ 156
antisense 5′- CTTACATTTTCAGTTAAAGGGAGACT −3’
Primers and probes used for Taq-Man duplex real-time PCR assay
 Primers sense 5′- TTTAGTGAGATTCTGAAGTTGAGCATAATA −3’ 78
antisense 5′- TCATTACTTCTTGCTGATCTTGACAA −3’
Probe for Wild-type allele 5′- (VIC)- CAATCTTTTTCCTTTTC-(MGB) −3’  
Probe for Mutant allele 5′- (FAM)-CAATCTTAATCCTTTTC-(MGB) −3’  
  1. VIC 2-chloro-7’-phenyl-1,4-dichloro-6-carboxy-fluorescein, FAM 6-carboxyfluorescein, NFQ nonfluorescent quencher, MGB minor groove binder