Skip to main content

Table 2 Primers used for GPV DNA amplification

From: Generation and molecular characteristics of a highly attenuated GPV strain through adaptation in GEF cells

Primer name Primer sequence (5′-3′) Position of the fragment
F1 TTCAGCTGCTCATTGGAGGGTT 1–203
(4903–5106)
R1 TTCTCGAGGCGTGGTCAACCTAACA
F2 CGCATGCCGCGCGGTCAGCCCAAT 196–1013
R2 TATGTATGCTGCAGTCACGGTCTT
F3 TAAGACCGTGACTGCAGCATAC 1009–2051
R3 TTCGCTCGTTCAGGAACGGGCTCTG
F4 CAGAGCCCGTTCCTGAACGAG 2022–3041
R4 CAGAGCCCGTTCCTGAACGAG
F5 CGAACCTGTGGCAGCATCTGAAATG 3010–4099
R5 GTCACTTATTCCTGCTGTAGTGCTG
F6 CAGCACTACAGCAGGAATAAG 4072–4911
R6 CGCATGCGCGCGGTCAGCCCAATAG
\