Skip to main content

Table 7 Primers for amplifying UdLAMPs using conventional PCR

From: Immunoinformatics and analysis of antigen distribution of Ureaplasma diversum strains isolated from different Brazilian states

UdLAMPs Forward Reverse Fragment length (bp)
gudiv_061 CAGTAAGTGTTGTTGCTG GTTACCGAAGTCTTGTCC 797
gudiv_066 AGCGTTGCCTTAGTTAGT TTAATCCGTCCCACATTG 965
gudiv_085 CAGGAAGTGCTACAGTTG ACTCATCATTTACCACCT TC 421
gudiv_091 CTGAAACCGCTTTAACAAG ACAACAAGCCGACTAAATC 652
gudiv_093a GGCTCAAGTAGTGAAGAGAAG GCAAATGGAATTGGATGTAC 680
TTCTGAACCTGAACCACAA CTAATTCACGACTGCCTT 937
gudiv_103 GTACCTAATCTCAATCAAGC CAACTAAGTCAACACGAG C 307
gudiv_159 CACCTAATCCATCAAAGAAC GTTTGTAGTAGAGTTGCCTA 260
gudiv_162 CTCAGTAACTACACCACTT TGCTTTACCTGTACGGAAT 298
gudiv_164 GTAGTAGGTTCAGTTCCT G GATCAGAAGATAGCGATCAG 732
gudiv_171 CCAGATGGTAATGCTGAAC CTACTCATGCTCTTAGTTC 547
gudiv_179 GCGAAGATCCTAAAGCAAT CGAACCTGAAGTAATAAGG 379
gudiv_180 GCTTGGAAGACAACTCTAA TTCTAGCACCTCAGGTAG 930
gudiv_228 GAGGAACTTTTAGTGATCCA CATGGTTATACAAAGGGGTG 125
gudiv_262a CATTAGGTATGGTTGCTGTA GTTTGATCGGCTCTTCTG 252
CATTAGGTATGGTTGCTG CTTCTGGCATCGGATTTG 543
gudiv_287 TGAGCAACCAAATACTGAAG GCTTGAGTTGATGTGTTTG 312
gudiv_331 GGTAAGCACGATCCTTGT TTTGTTTGCGGCTGAATC 178
gudiv_357 GGTAATTGGTGGTGTAATAG AAGTGATTCAGGAGTTGC 232
gudiv_388 CTATGGGTTTGGATTAGT CTTTTCTTTAGCAGCTTC 187
gudiv_398 CGTTATCAATACCACGACTTC TGGAATATGTCCTGATCG 351
gudiv_402 GGTAGAGGTAGTGGTTCA AGCAGATGGATCTTCGTAAT 945
gudiv_410 CACTAGAACCAGCAAAACC CCAAAATATCAGTCCGATCAG 819
gudiv_412 ACCACTTGTAGCACTAGA CTAAAATATCAGCCCGATCAG 830
gudiv_427 TTAGGATTGGTTGCTGTTG GATTGTTGTGGGTGAAAATC 509
gudiv_442 CTACCAGATAGTATTGCTC GGTGGACTTGTTAATGTATC 809
gudiv_457 CAGAAGAATCACTAGAGC CTGCTGGGTTATCACTTC 360
gudiv_458 CCAACCAACTCCTAAACTAG GCACTCCAAGTGATTCATC 482
gudiv_499 TAATCTTCCAACCCATCAAG CTTCTTTTGCTGTATGAGC 572
gudiv_517 AACCAACTTTGAGCAAGC GCTGCTTTAGAAAAGATAG 321
gudiv_546 CAGTTGCTTGTTCACAAC GGCTTGGTTTGGTTCAAA 266
gudiv_560 GGATCAGTTAGTGTACTTGTTG TTAGCAAAGGTTGGATCTTC 344
gudiv_635 GCAGTTGCTTCATCTATCT CTAGTCTTGCTACCTTATC 607
gudiv_663 CGCTACAACTATGACTGAT AATGGCTGACCAAATTGTG 243
gudiv_663 CTGATCCTACAGTGGTTAAAC CCATCAAAGATGAAGTCTTG 607
gudiv_680 GACAGAGTCTCCAAAACC TCTAACTGTTTCTTCATTAGGG 547
gudiv_681 GATTAGTTCAAGTGGTGAAG ATCATCAACAGCAGTCTT G 346
gudiv_759 GCTGATGAAGGATATTATGG GCAAGTGATAGATCGTTTG 749
  1. aTwo pairs of primers were designed for gudiv_93 and gudiv_262