Skip to main content

Table 3 PCR primers used to detect DNA extracted from the ticks taken from Xinjiang

From: Coxiella burnetii is widespread in ticks (Ixodidae) in the Xinjiang areas of China

Primers Target gene Primer sequence (5′ → 3′) Annealing temp (°C) Target fragment (bp) Reference sequence
F IS1111 GTGATCTACACGAGACGGGTT 55 517 M80806.1, KT391016.1, KT391020.1, KT391019.1, KT391018.1, KT391017.1, KT954146.1, KT391015.1, KT391014.1, KT391013.1, EU430257.1
R CGTAATCACCAATCGCTTCGT
16S-Fw 16S rRNA TCGGTGGHGAAGAAATTCTC 55 592 KP994776.1, GU797243.1, KP994812.1, KP994826.1, KP994854.1, D89792.1, NR_104916.1, FJ787329.1, HM208383.1, AY342037.1, MH769217.1, MK182891.1
16S-Rv AGGCACCAARTCATYTCTGACAAG