Skip to main content

Table 5 The primers used in the detection of APR resistance genes and expected amplicon sizes

From: Wild-type cutoff for Apramycin against Escherichia coli

Gene DNA sequence (5′–3′) Product (bp) Reference
aac(3)-IV aac(3)-IV F
aac(3)-IV R
TCGGTCAGCTTCTCAACCTT
GATGATCTGCTCTGCCTGTG
314 [43]
npmA npmA F
npmA R
CTCAAAGGAACAAAGACGG
GAAACATGGCCAGAAACTC
641 [43]
apmA apmA F
apmA R
CGTTTGCTTCGTGCATTAAA
TTGACACGAAGGAGGGTTTC
656 [15]