Skip to main content

Table 3 The primers used for detecting tetA, tetB, tetC and tetD genes in Escherichia coli isolates [12]

From: Antimicrobial resistance and prevalence of tetracycline resistance genes in Escherichia coli isolated from lesions of colibacillosis in broiler chickens in Sistan, Iran

Target gene Primer Primer sequences (5′ to 3′) Amplicon size (bp)
tetA tetA-F CGCCTTTCCTTTGGGTTCTCTATATC 182
  tetA-R CAGCCCACCGAGCACAGG  
tetB tetB-F GCCAGTCTTGCCAACGTTAT 975
  tetB-R ATAACACCGGTTGCATTGGT  
tetC tetC-F TTCAACCCAGTCAGCTCCTT 560
  tetC-R GGGAGGCAGACAAGGTATAGG  
tetD tetD-F GAGCGTACCGCCTGGTTC 780
  tetD-R TCTGATCAGCAGACAGATTGC