Skip to main content

Table 5 Oligonucleotide name, sequence and accession numbers of qRT-PCR primers

From: Impact of dietary zinc oxide nanoparticles on selected serum biomarkers, lipid peroxidation and tissue gene expression of antioxidant enzymes and cytokines in Japanese quail

Gene Sequence Accession # References
SOD1 F: TGGACCTCGTTTAGCTTGTG XM_015881247.1 [50]
R: ACACGGAAGAGCAAGTACAG
CAT F: CCTGACTATGGTGCGCGTAT NC_029520.1 Designed
R: CAGACACACGAGAAGTGGCT
GPX1 F: CAG TTC GGG CAT CAG GAGAA AB371709.1 [51]
R: CGA GGA ACT TGC TCGAAA GTT ACC AGG
GPX7 F: TTGTAAACATCAGGGGCAAA XM_015870585.1 [50]
R: TGGGCCAAGATCTTTCTGTAA
IL-6 F: CAACCTCAACCTGCCCAA XM_015853679.1 [52]
R: GGAGAGCTTCCTCAGGCATT
IFN-α F: CCTTGCTCCTTCAACGACA AB154298.1 [53]
R: CGCTGAGGATACTGAAGAGGT
β-actin F: CTGGCACCTAGCACAATGAA XM_015876619.1 [54]
R: CTGCTTGCTGATCCACATCT
  1. Abbreviations: qRT-PCR quantitative real time polymerase chain reaction, SOD1 super oxide dismutase-1, CAT catalase, GPX1 glutathione peroxidase-1, GPX7 glutathione peroxidase-7, IL-6 interleukin 6, IFN-α interfron α, β-actin beta actin