Skip to main content

Table 3 Primers and probes used in RT-PCR

From: Full genomic characterization of a porcine rotavirus strain detected in an asymptomatic piglet in Accra, Ghana

Genome SegmentProteinPrimer/probe sequencePredicted product size (bp)Reference
7NSP3NSP3-F: ACCATCTWCACRTRACCCTCTATGAG
NSP3-R: GGTCACATAACGCCCCTATAGC
NSP3-p: FAM5’-AGTTAAAAGCTAACACTGTCAAA-3’MGB
87 bp[32]
6VP6VP6F: GACGGVGCRACTACATGGT
VP6R: GTCCAATTCATNCCTGGTGG
380 bp[33]
2VP2VP2F1: ACAAGCGGCAAATGACTGTT
VP2R1: GGTTGATGACTTGTCCACTCC
398 bpThis paper
11NSP5NSP5F1: ACAACGTCAACTCTTTCTGGA
NSP5R1: TGCTTGAAGGTCGTGATTGC
232 bpThis paper
 SISPAFR26RV-N: GCCGGAGCTCTGCAGATATCNNNNNN
FR20RV: GCCGGAGCTCTGCAGATATC
 [34]