Skip to main content

Table 2 Details of primers used in this study

From: Molecular evidence of Babesia in pet cats in mainland China

genePrimersSequences (5′ → 3′)TmAmplicon (bp)Reference
18S rRNAPiro1-SF1: CTTGACGGTAGGGTATTGGC55 °C1400[27]
 Piro3-ASR1: CCTTCCTTTAAGTGATAAGGTTCAC  [27]
 Piro-AF2: ATTACCCAATMCBGACACVGKG55 °C407[27]
 Piro-BR2: TTAAATACGAATGCCCCCAAC  [27]
 P1F: AACCTGGTTGATCCTGCCAGTAGTCAT54 °C1700[20]
 P2R:GATCCTTCTGCAGGTTCACCTAC  [20]
ITS regionITS-FF: GAGAAGTCGTAACAAGGTTTCCG54 °C1100[20]
 ITS-2R: ACAATTTGCGTTCAATCCCA  [20]