Skip to main content

Table 7 Primer sequences, reference sequences, covered regions and positions in the mRNAs, and expected amplicon sizes for both the target and reference genes used in the qPCR analysis

From: Identification of the complete coding cDNAs and expression analysis of B4GALT1, LALBA, ST3GAL5, ST6GAL1 in the colostrum and milk of the Garganica and Maltese goat breeds to reveal possible implications for oligosaccharide biosynthesis

Gene symbolPrimer sequencesReference sequenceCovered region / PositionAmplicon, base pairs
B4GALT1FW-5’CTGTGTCTCGCCCAAATGCT3’
RW-5’AGGTGAGTGAGTTCAAACCATCAG3’
HQ700335.1Ex5fw/1011–1030
Ex6rw/1134–1157
147
LALBAFW-5’GATGACATTGTGTGTGCCAAGA3’
RW-5’AGTGCCACTGATCCAGCTTCTC3’
NM_001285635.1Ex3fw/330–351
Ex4rw/408–429
100
ST3GAL5FW-5’CCTGAACCAGTTTGATGTCG3’
RW-5’GGTGCACCTTCTGGATAAGTC3’
KF055858.2E4fw/655–673
E5rw/745–765
111
ST6GAL1FW-5’GAGCTGTGGGACATCATTCAAG3’
RW-5’CACACAGTGACATCATAATGGCAAT3’
HQ709167.1E5fw/1065–1086
E6rw/1140–1164
100
ATP5BFW-5’TTTGGACTCCACGTCTCGCATC3’
RW-5’TCCTGGAGGGATTTGTAGTCCTG3’
NM_175796.2Ex8fw/1219–1240
Ex9rw/1304–1326
108
EIF2B2FW-5’CCGTTCCCATTATGCTCAACTCCAG3’
RW-5’TCCGTTGTCCCTTCCAGTTCCAC3’
NM_001015593.1Ex3fw/395–419
Ex3-4rw/453–475
81
SDHAFW-5’ACGATTACTCCAAGCCCATCCAG3’
RW-5’AACGTAGGAGAGCGTGTGCTTC3’
NM_174178.2Ex14fw/1825–1847
Ex14rw/1883–1904
80
POLR2AFW-5′ AATGGAAGCATGTCAATGAGGACTCTC3’
RW-5′ CACAGGCAGCACAGTGACGATC3’
NM_001206313.1Ex5fw/602–628
Ex5rw/744–765
164
TBPFW-5’AACAGGTGCTAAAGTCAGAGCAG3’
RW-5′ GGAGAACACAGCAGCCATTACG3’
NM_001075742.1Ex8fw/1254–1276
Ex9rw/1334–1355
102
UXTFW-5’TGTGGCCCTTGGATATGGTT3’
RW-5’GGTTGTCGCTGAGCTCTGTG3’
NM_001037471.2Ex5fw/300–319
Ex5-6rw/381–400
101
RPS9FW-5’CCTCGACCAAGAGCTGAAG3’
RW-5’CCTCCAGACCTCACGTTTGTTC3’
NM_001101152.1Ex2fw/128–146
Ex3rw/170–191
54