Skip to main content

Table 6 Primer sequences, reference sequences, position in the reference, T.a. and amplicon size of target genes

From: Identification of the complete coding cDNAs and expression analysis of B4GALT1, LALBA, ST3GAL5, ST6GAL1 in the colostrum and milk of the Garganica and Maltese goat breeds to reveal possible implications for oligosaccharide biosynthesis

Gene symbolPrimer sequencesReference sequencePositionT.a.Amplicon base pair
B4GALT1FW-5’TAAAGCGGCGGCGGGAAGAT3’
RW-‘5AATGAGAGGGACCAGCCCA3’
NM_177512.2166–185
1460–1478
571313
B4GALT1FW-5’GTTTCTCAGCATCAATGGATTTCC3’
RW-5’GCTTTGATTCTTTGGGGTGA3’
NM_177512.21083–1106
1652–1672
58590
ST3GAL5FW-5’CCCGCTCCCTAATATGCGAA3’
RW-5’TGCGATCAGGATCCATGTAA3’
NM_20580730–49
342–361
58332
ST3GAL5FW-5’AATGCCAAGTGACCACAGC3’
RW-5’CGACATCAAACTGGTTCAGG3’
NM_205807129–147
684–704
58460
ST3GAL5FW-5’CCTGAACCAGTTTGATGTC3’
RW-5’CAGCATTGGAAGCACAGAGT3’
NM_205807684–704
1369–1389
58705
ST6GAL1FW-5’TCCTGAGAAGAATGAGCCTTG3’
RW-5’AGTGAGACAGGAGGCTCTGG3’
NM_17751715–35
1597–1617
561593
ST6GAL1FW-5’TGAAGTACCTCAACCTCGGCA3’
RW-5’GGGAAAGGTGGATCTTGCG3’
NM_1775171307–1329
1677–1696
58379
  1. T.a. = annealing temperature