Skip to main content

Table 2 Primers and probes

From: Development of oligonucleotide microarray for accurate and simultaneous detection of avian respiratory viral diseases

Name Sequence(5′-3′) Targeted gene and virus type Length
H9 probe TTCGACTGTCGCCTCATCTCTTG Haemagglutinin gene of AIV subtype H9 157
H9-F Biotin-CAGAACAAGAAGGCAGCAA
H9-R AATGTGATGACCARTGCATGG
H7 probe GGTTTAGCTTCGGGGCATCATG Haemagglutinin gene of AIV subtype H7 105
H7-F Biotin-CCATTRCAATGGCTAGAAG
H7-R AATAGAATACAGATWGACCCAGT
H5 probe GCCTCAAACTGAGTGTTCATTTTGT Haemagglutinin gene of AIV subtype H5 210
H5-F Biotin-GTACCACCATAGCAATGAGCAG
H5-R AGTCCAGACATCTAGGAATCCGT
M probe TCGGCTTTGAGGGGGCCTGA M gene of all subtypes of AIV 163
M-F Biotin-ATGAGYCTTCTRACCGAGGTCG
M-R GAGGTGACAGGATTGGTCTTGTC
IBV probe CGCCCATCCTTAATACCTTCCTCA N gene of IBV and all pathotypes of IBV 175
IBV-F Biotin-GTARGGAGGGNAATTTTGGTGATGA
IBV-R ACACACTSRTCACAAATYTTYACATAATTA
NDV probe GAGGTGTCAAGYTCTTCTATCACAGAACC F gene of NDV and all pathotypes of NDV 107
NDV-F Biotin-GTCCCRAARGTRGTGACACA
NDV-R GGGAAYTGTCACTATYCTDGTACA