Skip to main content

Table 5 Sequences and melting temperature (Tm) of the oligos for EMSA

From: A single nucleotide variant in the promoter region of the CCR5 gene increases susceptibility to arthritis encephalitis virus in goats

Oligo name Sequence 5′-3’ Tm
CCR5_SNPg.1059_C_f CTGGCTTCCACAAACACCAAGTGGGTCAGA 76 °C
CCR5_SNPg.1059_C_r TCTGACCCACTTGGTGTTTGTGGAAGCCAG
CCR5_SNPg.1059_T_f CTGGCTTCCACAAATACCAAGTGGGTCAGA 73.3 °C
CCR5_SNPg.1059_T_r TCTGACCCACTTGGTATTTGTGGAAGCCAG
  1. The polymorphic nucleotides of the SNPg.1059 are given in bold