Skip to main content

Table 5 Primers used to detect ESBL-resistance genes and genotypes in broiler farm isolates

From: Prevalence and distribution of blaCTX-M, blaSHV, blaTEM genes in extended- spectrum β- lactamase- producing E. coli isolates from broiler farms in the Philippines

Target gene Primer Sequence (5 → 3) Annealing Temp (°C) Size (bp) Ref
bla CTX-M CTX-M-F
CTX-M-R
ATGTGCAGYACCAGTAARGTKATGGC
TGGGTRAARTARGTSACCAGAAYSAGCGG
55 592 [29]
bla CTX-M-1group CTX-M-1-F
CTX-M-1-R
GGTTAAAAAATCACTGCGTC
TTACAAACCGTYGGTGACGA
50 873 [29]
bla CTX-M-15 CTX-M-15-F
CTX-M-15-R
CACACGTGGAATTTAGGGACT
GCCGTCTAAGGCGATAAACA
50 995 [30]
bla CTX-M-2group CTX-M-2-F
CTX-M-2-R
ATGATGACTCAGAGCATTCGCCGC
TCAGAAACCGTGGGTTACGATTTT
56 876 [31]
bla CTX-M-8group CTX-M-8-F
CTX-M-8-R
TGATGAGACATCGCGTTAAG
TAACCGTCGGTGACGATTTT
52 666 [32]
bla CTX-M-9group CTX-M-9-F
CTX-M-9-R
GTGACAAAGAGAGTGCAACGG
ATGATTCTCGCCGCTGAAGCC
55 856 [33]
bla CTX-M-25group CTX-M-25-F
CTX-M-25-R
GCACGATGACATTCGGG
AACCCACGATGTGGGTAGC
52 327 [34]
bla TEM TEM-F
TEM-R
TTGGGTGCACGAGTGGGTTA
TAATTGTTGCCGGGAAGCTA
55 506 [35]
bla SHV SHV-F
SHV-R
TCGGGCCGCGTAGGCATGAT
AGCAGGGCGACAATCCCGCG
52 628 [35]