Skip to main content

Table 2 Cytokines primers used for the real time PCR

From: Protective effect of chicken egg yolk immunoglobulins (IgY) against enterotoxigenic Escherichia coli K88 adhesion in weaned piglets

Target gene Orientation Sequence (5′-3′) T m (°C) Product size (bp)
β-actin Forward AGTTGAAGGTGGTCTCGTGG 57.4 216
Reverse TGCGGGACATCAAGGAGAAG   
TNF-α Forward ACAGGCCAGCTCCCTCTTAT 53.9 102
Reverse CCTCGCCCTCCTGAATAAAT   
IL-22 Forward AGCAAGCGTGAAGGTGCGGTT 60 169
Reverse GCGGACATCTGGGAGCCCTTT   
IL-6 Forward GGCAAAAGGGAAAGAATCCAG 57 87
Reverse CGTTCTGTGACTGCAGCTTATCC   
IL-1β Forward CCTGGACCTTGGTTCTCT 53 123
Reverse GGATTCTTCATCGGCTTCT   
  1. Abbreviations: TNF-α tumor necrosis factor alpha, IL-22 interleukin 22, IL-6 interleukin 6, IL-1β interleukin 1β, T m (°C) melting temperature