Skip to main content

Table 2 Virulence factors, sequence of primers, references and expected amplicon size of target gene used in this study

From: Virulence-associated genes and antibiotic resistance patterns of Vibrio spp. isolated from cultured marine fishes in Malaysia

Gene Virulence factor Primer sequence (5′-3′) Reference Amplicon size (bp)
chiA Chitinase F: GGAAGATGGCGTGATTGACT R: GGCATCAATTTCCCAAGAGA [21] 232
vhpA Metalloprotease F: CTGAACGACGCCCATTATTT R:CGCTGACACATCAAGGCTAA [21] 201
luxR Quorum sensing factors F: ATGGACTCAATTGCAAAGAG R: TTAGTGATGTTCACGGTTGT [21] 618
flaC Flagella of V. anguillarum F: AAATCATTCCAAATCGGTGC R: TCTTTGATTCGGCTCTTA [25] 580
hlyA Haemolysin of V. cholera F: GGCAAACAGCGAAACAAATAC C R: CTCAGCGGGCTAATACGGTTTA [48] 738
toxR Vc Toxin of V. cholera F: ATG TTC GGA TTA GGA CAC R: TAC TCA CAC ACT TTG ATG GC [49] 883
tlh Thermolabile haemolysin of V. parahaemolyticus F: AAAGCGGATTATGCAGAAGCACTG R: GCTACTTTCTAGCATTTTCTCTGC [27] 450
tdh Thermostable direct haemolysin (TDH) of V. parahaemolyticus F: GTAAAGGTCTCTGACTTTTGGAC R: TGGAATAGAACCTTCATCTTCACC [27] 269
trh TDH-related haemolysin (TRH) of V. parahaemolyticus F: TTGGCTTCGATATTTTCAGTATCT R: CATAACAAACATATGCCCATTTCCG [27] 500