Skip to main content

Table 1 Sequence, position and specificity of primers used in this study

From: Simultaneous detection and differentiation of canine parvovirus and feline parvovirus by high resolution melting analysis

Assay Primer Sequence 5’to 3’ Positiona Amplicon size
Standard DNA F1 ATTATTTGTAAAAGTTGCGCC 4276–4296 361 bp
R1 CTAAATCCTATATCAAATACAAGTACAA 4609–4636
HRM assay F2 TCAGATTTTTGGTGGAAAGGTAA 4358–4380 101 bp
R2 TGGTTATCTACATTAATACTCATTTGTTG 4430–4458
  1. aPrimer positions are referred to the sequence of CPV strain Laika-1993 (GenBank accession number: JN033694)