Skip to main content

Table 1 Primer and probe sequences used for RPA-LFD assay

From: Development of a recombinase polymerase amplification combined with a lateral flow dipstick assay for rapid detection of the Mycoplasma bovis

Name Sequence (5′-3′) Genome location Amplification size (bp)
uvrC-F1 TAAATGAGCGCAGTGCTGATGTTGAAT 1464–1490 281
uvrC-F2 GTAGCAACAAAAACACTAAAGATTATGACT 1521–1550 224
uvrC-F3 CTTAAAACGCTTAATATAAACATCCCTGT 1601–1629 144
uvrC-F4 AACGCTTAATATAAACATCCCTGTTATTG 1606–1634 139
uvrC-R Biotin-AACTTGAATTTGAACTAAGTAGTTGTATAG 1715–1744  
uvrC-LF Probe FAM-AAATGAGTTTCACAAAACCAAAGCCTTAAT
[dSpacer]GACCTAGATATGAATGA-C3 Spacers
1645–1692 100
oppD-oppF-F1 TTGAACAAATACGTCAAGAGTACAATATA 22–50 234
oppD-oppF-F2 CAATATATCAATAATTTTAATTTCGCATAACA 44–75 212
oppD-oppF-F3 TGTTATGTATGCTGGCAAAATTGTTGAAAGA 110–140 146
oppD-oppF-R Biotin-CTGGTGGGGTTCCTTGAATTGAGAATAATCT 225–255  
oppD-oppF-LF Probe FAM-TCCAGCTCACCCTTATACATGAGCGCTTATC
[dSpacer]CGGCTATACCTGAA-C3 Spacers
167–212 89
  1. Abbreviations: FAM is 6-Carboxyfluorescein, dSpacer is an exonuclease site, and C3 Spacers is a polymerase extension blocking site