Skip to main content

Table 7 Primers for RT-qPCR genes based on the ovis sequences obtained from the NCBI database

From: An intensive milk replacer feeding program benefits immune response and intestinal microbiota of lambs during weaning

Gene   Primer sequences (5′–3′) Amplicon size NCBI accession no.
CXCL8 F: AGAGAGCTGAGAAGCAAGATCCA 150 bp NM_001009401.2
  R: CCCTACACCAGACCCACACA   
IL-1β F: GGCAGAAGGGAAGGGAAGA 81 bp NM_001009465
  R: AATACAGGGGAGGCAGTTGG   
GRα F: TGCCAAGGGTCTGGAGATG 132 bp NM_001114186.1
  R: TGAGGAACTGGATGGAGGAGA   
TLR4 F: GACCCTTGCGTACAGGTTGTT 80 bp NM_001135930.1
  R: GGGATGTTGTCGGGGATTT   
TNFα F: ACGGCGTGGAGCTGAAA 132 bp NM_001114186.1
  R: CTGATGGTGTGGGTGAGGAA   
IFN-γ F: TGGAGGACTTCAAAAGGCTGA 183 bp NM_001009803.1
  R: GCAGGCAGGAGAACCATTACA   
Fas F: GATATTGCTTGGCTTGGCTTT 167 bp NM_001123003.1
  R: CCAGCATTCATCTCCCCAAC   
NFκB1 F: AGCACCACTTATGACGGAACTACA 168 bp XM_004009667.3
  R: GACCCCTTCATCCTCTCCATC   
NFκB2 F: GGAGGCCAAGGAACTGAAGA 101 bp XM_004020143.3
  R: TCAGGGGCAGAGAGAAGGAG   
CD62L F: CGGAGAAGCACGGTTGATG 198 bp XM_012187246.2
  R: CAAAGAGGGGACAGAAGGAGAAG   
β-actin F: CCTGCGGCATTCACGAA 134 bp NM_001009784.2
  R: GCGGATGTCGACGTCACA