Skip to main content

Table 3 Characteristics of primer sequences used for quantitative real-time RT-PCR analysis

From: Agrimonia procera exerts antimicrobial effects, modulates the expression of defensins and cytokines in colonocytes and increases the immune response in lipopolysaccharide-challenged piglets

Gene Forward primer (from 5′ to 3′)
Reverse primer (from 5′ to 3′)
Product size (bp) NCBI GenBank number
CXCL1 ATGCTGAACAGTGACAAATC 96 NM_001511.3
TCTTCTGTTCCTATAAGGGC
IL-8 GTTTTTGAAGAGGGCTGAG 89 NM_000584.4
TTTGCTTGAAGTTTCACTGG
GPX2 AATTTGGACATCAGAACTGC 190 NM_001115136.1
GGCTGCTCTTCAAGATTTAG
DEFB1 AGGTGGTAACTTTCTCACAG 192 NM_005218.3
AAGTTCATTTCACTTCTGCG
GAPDH GACCACAGTCCATGCCATCAC 453 NM_002046.5
TCCACCACCCTGTTGCTGTAG
RPLP0 TCGACAATGGCAGCATCTAC 223 NM_001002.3
GCCTTGACCTTTTCAGCAAG  
  1. CXCL1 Chemokine (C-X-C motif) ligand 1, IL-8 Interleukin-8, GPX2 Glutathione peroxidase 2, DEFB1 Beta-defensin 1, GAPDH Glyceraldehyde 3-phosphate dehydrogenase, RPLP0 Ribosomal phosphoprotein P0