Skip to main content

Table 1 Porcine specific primers used for gene expression analysis

From: Isolation and characterization of GFAP-positive porcine neural stem/progenitor cells derived from a GFAP-CreERT2 transgenic piglet

Genes Primer sequences Products
size (bp)
CreER T2 5’-TCGCAAGAACCTGATGGACA-3′ 288
5’-CGCCGCATAACCAGTGAAAC-3′
eGFP 5’-AACGGCCACAAGTTCAGCGT-3′ 424
5′- TCACCTTGATGCCGTTCTTC -3’
Notch1 5’-TGGATGGCATCAATTCCTTT-3’ 138
5′- ACTTGTAGGCGCCATAGCTG-3’
Hes5 5’-TTCTCAGAGAATGTGTGTGCAGAGT-3’ 75
5’-GGTCAGACACTTGGCAGAAGATG-3’
Sox2 5’-CGGCGGCAGGATCGGC-3’ 113
5’-GAGCTCCGCGAGGAAAA-3’
GFAP 5’-CACAAGGATGTGGTGTGAGG-3’ 207
5’-TGCTACCTGGCAGGCTTAAT-3’
Ki67 5’-GAAACCCAGATCCGAGCATA-3’ 139
5’-CAGCAGCTATTCTGGCAACA-3’
GAPDH 5’-GTCGGTTGTGGATCTGACCT-3’ 207
5’-TTGACGAAGTGGTCGTTGAG-3’
RN18S 5’-CGCGGTTCTATTTTGTTGGT-3’ 219
5’-AGTCGGCATCGTTTATGGTC-3’