Skip to main content

Table 1 Oligonucleotide primers used for screening bat samples of Coxiella burnetii, Bartonella spp., Rickettsia spp., Ehrlichia spp. and Anaplasma spp.

From: Coxiella and Bartonella spp. in bats (Chiroptera) captured in the Brazilian Atlantic Forest biome

Pathogen Target gene Oligonucleotide primer Primer sequence (5′ – 3′) Amplicon size (bp) Cycling conditions Reference
Coxiella burnetii IS1111 Outer primer F
Outer primer R
Nested primer F
Nested primer R
TATGTATCCACCGTAGCCAGC
CCCAACAACACCTCCTTATTC
AAGCGTGTGGAGGAGCGAACC
CTCGTAATCACCAATCGCTTCGTC
687 bp
440 bp
95 °C for 5 min, 40 cycles of 95 °C for 30s, 60 °C for 30s, 72 °C for 1 min, final extension of 72 °C for 7 min
95 °C for 5 min, 30 cycles of 95 °C for 30 s, 66 °C for 30 s, 72 °C for 30 s, final extension of 72 °C for 5 min
[36]
[35, 37]
Bartonella spp. gltA Outer primer F
Outer primer R
GCTATGTCTGCVTTCTATCAYGA
AGAACAGTAAACATTTCN GTHGG
731 bp 95 °C for 10 min, 35 cycles of 95 °C for 30s, 58 °C for 30s, 72 °C for 1 min, final extension of 72 °C for 8 min [35]
Rickettsia spp. gltA Outer primer F
Outer primer R
Nested primer F
Nested primer R
CATCCTATGGCTATTATGCTTGC
TATACTCTCTATG(T/A)AC(A/G)T(A/G)ACC
CTTACCGCTATTAGAATGATTGC
GAGCGA(T/G)AGCTTCAAG(T/C)TCTAT
885 bp
572 bp
95 °C for 10 min, 30 cycles of 95 °C for 30 s, 55 °C for 40 s, 72 °C for 55 s, final extension of 72 °C for 10 min
95 °C for 7 min, 25 cycles of 95 °C for 30 s, 63 °C for 30 s, 72 °C for 35 s, final extension of 72 °C for 10 min
[35]
[35]
Ehrlichia spp. /Anaplasma spp. 16 s rRNA Outer primer F
Outer primer R
GGTACCYACAGAAGAAGTCC
TGCACTCATCGTTTACAG
345 bp 95 °C for 3 min, 35 cycles of 95 °C for 15 s, 55 °C for 30 s, 72 °C for 30s, final extension of 72 °C for 5 min [38]